null

Human UBE2J1 cDNA Clone BC013973 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL896502HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2J1
Gene ID:
51465
Accession #:
BC013973
Plasmid:
pUC
€348.00
Frequently bought together:

Description

Human UBE2J1 cDNA Clone BC013973 pUC Plasmid | Cusabio

Gene Name: UBE2J1

Gene ID: 51465

Accession Number: BC013973

Vector: pUC

Sequence: ATGGAGACCCGCTACAACCTGAAGAGTCCGGCTGTTAAACGTTTAATGAAAGAAGCGGCAGAATTGAAAGATCCAACAGATCATTACCATGCGCAGCCTTTAGAGGATAACCTTTTTGAATGGCACTTCACGGTTAGAGGGCCCCCAGACTCCGATTTTGATGGAGGAGTTTATCACGGGCGGATAGTACTGCCACCAGAGTATCCCATGAAACCACCAAGCATTATTCTCCTAACGGCTAATGGTCGATTTGAAGTGGGCAAGAAAATCTGTTTGAGCATCTCAGGCCATCATCCTGAAACTTGGCAGCCTTCGTGGAGTATAAGGACAGCATTATTAGCCATCATTGGGTTTATGCCAACAAAAGGAGAGGGAGCCATAGGTTCTCTAGATTACACTCCTGAGGAAAGAAGAGCACTTGCCAAAAAATCACAAGATTTCTGTTGTGAAGGATGTGGCTCTGCCATGAAGGATGTCCTGTTGCCTTTAAAATCTGGAAGCGATTCAAGCCAAGCTGACCAAGAAGCCAAAGAACTGGCTAGGCAAATAAGCTTTAAGGCAGAAGTCAATTCATCTGGAAAGACTATCTCTGAGTCAGACTTAAACCACTCTTTTTCACTAACTGATTTACAAGATGATATACCTACAACATTCCAGGGTGCTACGGCCAGTACATCGTACGGAGTCCAGAATTCCTCAGCAGCATCCTTTCATCAACCTACCCAACCTGTAGCTAAGAATACCTCCATGAGCCCTCGACAGCGCCGGGCCCAGCAGCAGAGTCAGAGAAGGTTGTCTACTTCACCAGATGTAATCCAGGGCCACCAGCCAAGAGACAACCACACTGATCATGGTGGGTCAGCTGTACTGATTGTCATCCTGACTTTGGCATTGGCAGCTCTTATATTCCGACGAATATATCTGGCAAACGAATACATATTTGACTTTGAGTTATAA

Length: 957

View AllClose

0 Reviews

View AllClose