Human AACS cDNA Clone BC051862 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001012HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
AACS
Gene ID:
65985
Accession #:
BC051862
Plasmid:
pUC
€625.00
Frequently bought together:

Description

Human AACS cDNA Clone BC051862 pUC Plasmid | Cusabio

Gene Name: AACS

Gene ID: 65985

Accession Number: BC051862

Vector: pUC

Sequence: ATGTCCAAGGAGGAGCGCCCCGGTCGGGAGGAGATCCTGGAGTGCCAGGTGATGTGGGAGCCTGACAGTAAGAAGAACACGCAGATGGACCGCTTCCGGGCGGCTGTGGGCGCCGCCTGCGGCCTGGCGCTGGAGAGTTATGATGACTTGTACCATTGGTCCGTTGAGTCATATTCAGACTTCTGGGCAGAGTTCTGGAAATTCAGTGGAATTGTCTTCTCACGTGTGTATGATGAGGTTGTGGACACATCGAAAGGAATCGCAGATGTCCCCGAGTGGTTCAAAGGCAGTCGGCTCAACTATGCAGAAAACCTCCTGCGGCACAAAGAGAATGACAGAGTTGCCCTTTACATTGCAAGGGAAGGCAAAGAGGAAATTGTGAAGGTGACTTTTGAAGAGCTGAGGCAAGAAGTGGCTTTGTTTGCAGCAGCAATGAGGAAAATGGGTGTGAAGAAAGGAGATCGGGTTGTTGGTTATTTACCCAACAGTGAGCACGCTGTCGAGGCGATGCTGGCTGCGGCAAGCATTGGTGCCATCTGGAGCTCCACGTCCCCGGACTTCGGTGTGAATGGTGTGCTGGACCGGTTTTCTCAAATTCAGCCAAAGCTCATCTTCTCTGTGGAGGCTGTTGTCTATAATGGCAAAGAGCACAACCACATGGAAAAGCTGCAGCAGGTGGTTAAAGGCCTACCAGACTTGAAGAAAGTGGTGGTGATTCCTTATGTGTCCTCCAGAGAGAACATAGACCTTTCAAAGATTCCAAACAGTGTGTTTCTGGATGACTTTCTTGCCACCGGCACCAGTGAGCAGGCCCCGCAGCTGGAGTTCGAGCAGCTGCCCTTCAGCCACCCACTGTTCATCATGTTCTCATCGGGCACCACGGGCGCACCCAAGTGCATGGTGCATTCCGCTGGGGGCACCCTCATCCAGCATCTGAAGGAGCACCTGCTGCACGGCAACATGACCAGCAGTGACATCCTCCTGTGCTACACCACGGTCGGCTGGATGATGTGGAACTGGATGGTGTCCCTTCTGGCCACAGGAGCGGCCATGGTCTTGTACGATGGCTCCCCCCTGGTGCCCACGCCCAATGTGCTCTGGGACCTGGTTGACAGGATAGGCATCACTGTCCTGGTAACTGGGGCCAAGTGGCTGTCAGTGCTGGAAGAGAAGGCCATGAAGCCGGTGGAAACCCACAGTCTCCAGATGCTCCACACGATCCTGTCCACTGGCTCCCCACTGAAAGCCCAGAGCTACGAGTATGTCTACAGGTGCATCAAGAGCAGCATCCTCCTGGGCTCCATCTCAGGAGGCACCGACATCATCTCCTGCTTCATGGGCCACAATTTTTCTCTTCCTGTGTATAAAGGGGAGATTCAGGCCCGGAACCTGGGCATGGCCGTGGAAGCGTGGAACGAGGAAGGAAAGGCGGTCTGGGGAGAGAGCGGCGAGCTGGTGTGTACTAAGCCGATCCCTTGCCAGCCCACACACTTCTGGAACGATGAGAACGGCAACAAGTACAGGAAGGCGTATTTCTCCAAATTCCCAGGTATCTGGGCTCATGGCGACTACTGCAGAATCAACCCCAAGACCGGGGGCATCGTCATGCTTGGCCGGAGTGACGGCACCCTCAACCCCAACGGGGTGCGGTTCGGCAGCTCGGAAATCTATAACATTGTGGAATCCTTCGAGGAGGTGGAGGACAGCCTGTGTGTCCCCCAGTATAACAAGTACAGGGAGGAGAGGGTGATCCTCTTCCTGAAGATGGCCTCCGGGCACGCCTTCCAGCCTGACTTGGTTAAGAGGATCCGTGACGCCATCCGCATGGGCTTGTCTGCGCGACACGTGCCCAGCCTCATCCTGGAAACCAAGGGCATCCCGTATACGCTCAACGGCAAGAAAGTGGAAGTTGCCGTCAAACAGATCATCGCTGGAAAAGCCGTGGAGCAAGGAGGTGCTTTCTCGAACCCCGAGACCCTGGATCTGTACCGGGACATCCCTGAGCTGCAGGGCTTCTGA

Length: 2019

View AllClose

0 Reviews

View AllClose