Human ADAM17 cDNA Clone BC062687 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL001277HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ADAM17
Gene ID:
6868
Accession #:
BC062687
Plasmid:
pUC
€263.00
Frequently bought together:

Description

Human ADAM17 cDNA Clone BC062687 pUC Plasmid | Cusabio

Gene Name: ADAM17

Gene ID: 6868

Accession Number: BC062687

Vector: pUC

Sequence: ATGAGGCAGTCTCTCCTATTCCTGACCAGCGTGGTTCCTTTCGTGCTGGCGCCGCGACCTCCGGATGACCCGGGCTTCGGCCCCCACCAGAGACTCGAGAAGCTTGATTCTTTGCTCTCAGACTACGATATTCTCTCTTTATCTAATATCCAGCAGCATTCGGTAAGAAAAAGAGATCTACAGACTTCAACACATGTAGAAACACTACTAACTTTTTCAGCTTTGAAAAGGCATTTTAAATTATACCTGACATCAAGTACTGAACGTTTTTCACAAAATTTCAAGGTCGTGGTGGTGGATGGTAAAAACGAAAGCGAGTACACTGTAAAATGGCAGGACTTCTTCACTGGACACGTGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGGTAAGACTTAA

Length: 630

View AllClose

0 Reviews

View AllClose