null

Human JSRP1 cDNA Clone BC021201 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL011969HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
JSRP1
Gene ID:
126306
Accession #:
BC021201
Plasmid:
pUC
€358.00
Frequently bought together:

Description

Human JSRP1 cDNA Clone BC021201 pUC Plasmid | Cusabio

Gene Name: JSRP1

Gene ID: 126306

Accession Number: BC021201

Vector: pUC

Sequence: ATGTCCATGACAACCAGAGCCTGGGAGGAGCTGGATGGCGGCCTGGGCAGCTGCCAGGCCCTGGAGGACCACTCTGCGCTGGCCGAGACCCAGGAGGACAGGGCTTCAGCGACACCCAGGCTGGCCGACTCCGGCAGCGTGCCCCACGACTCTCAGGTGGCTGAAGGCCCCAGTGTGGACACCAGGCCCAAGAAGATGGAAAAAGAGCCTGCCGCCAGGGGGACCCCAGGAACGGGGAAGGAGAGGCTGAAAGCCGGAGCGAGCCCTCGGAGCGTCCCCGCGCGCAAGAAGGCGCAGACCGCGCCGCCCCTGCAGCCGCCGCCGCCGCCCCCGGCCCTGAGCGAGGAGCTGCCCTGGGGAGACCTGTCGCTCAACAAGTGCCTGGTGCTCGCCTCGCTGGTGGCGCTGCTGGGCTCGGCTTTCCAGCTGTGCCGCGACGCCGTCCCTGGGGAGGCAGCACTCCAAGCACGTGTGCCCGAGCCCTGGGTCCCGCCAAGCTCAGCCCCGAGGGAGCCATCGTCGCCCCTGCCTAAGTTCGAGGCCCAGGCGCCTCCATCAGCGCCGCCTGCGCCCCGGGCCGAGGCAGAGGTCAGACCCAAGATTCCCGGGAGTCGGGAGGCTGCAGAGAACGACGAAGAGGAGCCCGGCGAGGCCACCGGAGAGGCCGTCCGGGAGGACCGTGTGACCCTCGCAGACCGGGGACCCAAGGAGAGGCCTCGGAGAGAGGGGAAGCCGCGGAAGGAGAAGCCGCGGAAGGAGGAGAGACCTAAGAAAGAGAGGCCGCGGAAAGAGGAGAGGCCACGGGCCGCCAGGGAGCCCCGGGAAGCCCTACCCCAGCGCTGGGAGTCACGCGAAGGGGGCCACCGGCCGTGGGCACGGGACTCCAGGGACGCCGAGCCCAGGAAGAAGCAGGCCTGGGTGTCCCCGAGGCGTCCCGACGAGGAGCAGCGGCCTGGGAGTCGCCAGAAGCTCCGCGCAGGCAAGGGGCGGGACTGA

Length: 996

View AllClose

0 Reviews

View AllClose