Human EHD4 cDNA Clone BC051823 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL872437HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EHD4
Gene ID:
30844
Accession #:
BC051823
Plasmid:
pUC
€522.00
Frequently bought together:

Description

Human EHD4 cDNA Clone BC051823 pUC Plasmid | Cusabio

Gene Name: EHD4

Gene ID: 30844

Accession Number: BC051823

Vector: pUC

Sequence: ATGTTCAGCTGGATGGGGCGGCAGGCGGGCGGGCGCGAACGCGCTGGCGGCGCGGACGCGGTGCAGACGGTGACGGGCGGGCTGCGCTCGCTCTACCTGCGCAAGGTGCTGCCGCTGGAGGAGGCGTACCGCTTCCACGAGTTCCACTCGCCTGCGCTGGAGGACGCCGACTTCGAGAACAAGCCCATGATCCTGCTGGTGGGCCAGTACAGCACCGGCAAGACCACCTTCATCAGATACCTACTGGAGCAGGATTTCCCAGGCATGAGGATTGGTCCGGAGCCCACCACAGACTCCTTCATCGCCGTGATGTATGGAGAGACTGAGGGCAGCACCCCAGGGAATGCTTTAGTCGTGGACCCCAAAAAGCCGTTTAGAAAGCTCAGTCGCTTTGGAAACGCTTTCCTGAATCGATTCATGTGCTCACAGCTCCCCAATCAGGTCCTGAAGAGCATCAGCGTCATCGACAGCCCCGGCATCCTTTCTGGGGAGAAGCAGCGCATCAGCCGAGGCTATGACTTCTGCCAGGTCCTGCAGTGGTTTGCCGAGAGGGTGGACAGGATCATCCTGCTCTTTGACGCTCACAAGCTGGACATCTCAGATGAATTCTCAGAGGCCATCAAGGCCTTCCGGGGCCAGGACGACAAGATCCGTGTCGTGCTGAACAAGGCCGACCAAGTGGACACGCAGCAGCTGATGCGGGTCTACGGGGCCCTCATGTGGTCCCTAGGCAAGGTCATCAACACGCCCGAGGTACTGCGCGTCTACATTGGCTCCTTCTGGGCGCAGCCCCTGCAGAACACGGACAACCGCCGGCTCTTCGAGGCTGAGGCCCAGGACCTCTTCAGAGACATCCAGAGCCTCCCCCAGAAGGCAGCGGTGCGCAAGCTCAACGACCTCATCAAGCGAGCGAGGCTGGCCAAGGTGCATGCCTACATCATCAGCTACCTGAAGAAGGAGATGCCAAGTGTATTTGGAAAGGAAAACAAGAAGAGAGAGCTTATCAGCAGGCTACCGGAAATCTACATTCAGCTACAGCGAGAATACCAGATTTCTGCAGGGGACTTCCCTGAGGTCAAGGCTATGCAGGAACAGCTTGAGAACTATGACTTCACCAAATTCCACTCGCTGAAGCCCAAGCTGATCGAGGCAGTGGACAACATGCTGAGCAACAAGATCTCGCCCCTCATGAACCTCATCAGCCAGGAGGAGACGAGCACGCCCACGCAGCTGGTGCAGGGCGGCGCCTTCGATGGCACCACCGAGGGCCCCTTCAACCAGGGCTACGGGGAGGGTGCCAAGGAGGGCGCCGACGAGGAGGAGTGGGTCGTGGCCAAAGACAAGCCCGTCTACGACGAGCTCTTCTACACTCTGTCGCCCATCAATGGCAAGATATCAGGTGTCAACGCCAAGAAGGAGATGGTGACCTCCAAGCTGCCCAACAGCGTCCTGGGCAAGATCTGGAAGCTGGCCGACTGCGACTGCGACGGCATGCTTGATGAGGAGGAGTTCGCGCTGGCCAAGCACCTCATCAAGATCAAGCTCGACGGCTACGAGCTGCCCAGCAGCCTGCCCCCCCACCTCGTGCCCCCCTCGCACAGGAAGTCCCTGCCCAAGGCCGACTGA

Length: 1626

View AllClose

0 Reviews

View AllClose