Human EED cDNA Clone BC068995 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007408HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EED
Gene ID:
8726
Accession #:
BC068995
Plasmid:
pUC
€464.00
Frequently bought together:

Description

Human EED cDNA Clone BC068995 pUC Plasmid | Cusabio

Gene Name: EED

Gene ID: 8726

Accession Number: BC068995

Vector: pUC

Sequence: ATGTCCGAGAGGGAAGTGTCGACTGCGCCGGCGGGAACAGACATGCCTGCGGCCAAGAAGCAGAAGCTGAGCAGTGACGAGAACAGCAATCCAGACCTCTCTGGAGACGAGAATGATGACGCTGTCAGTATAGAAAGTGGTACAAACACTGAACGCCCTGATACACCTACAAACACGCCAAATGCACCTGGAAGGAAAAGTTGGGGAAAGGGAAAATGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGGCGTAGAAGGGCACAGAGATGAAGTTCTAAGTGCTGATTATGATCTTTTGGGTGAAAAAATAATGTCCTGTGGTATGGATCATTCTCTTAAACTTTGGAGGATCAATTCAAAGAGAATGATGAATGCAATTAAGGAATCTTATGATTATAATCCAAATAAAACTAACAGGCCATTTATTTCTCAGAAAATCCATTTTCCTGATTTTTCTACCAGAGACATACATAGGAATTATGTTGATTGTGTGCGATGGTTAGGCGATTTGATACTTTCTAAGAGTGGCCGTGCCATTTTACATTCCCACCAGCAATGTATGAGAGATCCAGTGTCTCCGAATCTTCGCCAGCATTTGTCTTGTGAAAATGCCATTGTGTGCTGGAAACCTGGCAAGATGGAAGATGATATAGATAAAATTAAACCCAGTGAATCTAATGTGACTATTCTTGGGCGATTTGATTACAGCCAGTGTGACATTTGGTACATGAGGTTTTCTATGGATTTCTGGCAAAAGATGCTTGCATTGGGCAATCAAGTTGGCAAACTTTATGTTTGGGATTTAGAAGTAGAAGATCCTCATAAAGCCAAATGTACAACACTGACTCATCATAAATGTGGTGCTGCTATTCGACAAACCAGTTTTAGCAGGGATAGCAGCATTCTTATAGCTGTTTGTGATGATGCCAGTATTTGGCGCTGGGATCGACTTCGATAA

Length: 1401

View AllClose

0 Reviews

View AllClose