Human ECE1 cDNA Clone BC117256 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007371HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ECE1
Gene ID:
1889
Accession #:
BC117256
Plasmid:
pUC
€701.00
Frequently bought together:

Description

Human ECE1 cDNA Clone BC117256 pUC Plasmid | Cusabio

Gene Name: ECE1

Gene ID: 1889

Accession Number: BC117256

Vector: pUC

Sequence: ATGCGGGGCGTGTGGCCGCCCCCGGTGTCCGCCCTGCTGTCGGCGCTGGGGATGTCGACGTACAAGCGGGCCACGCTGGACGAGGAGGACCTGGTGGACTCGCTCTCCGAGGGCGACGCATACCCCAACGGCCTGCAGGTGAACTTCCACAGCCCCCGGAGTGGCCAGAGGTGCTGGGCTGCACGGACCCAGGTGGAGAAGCGGCTGGTGGTGTTGGTGGTACTTCTGGCGGCAGGACTGGTGGCCTGCTTGGCAGCACTGGGCATCCAGTACCAGACAAGATCCCCCTCTGTGTGCCTGAGCGAAGCTTGTGTCTCAGTGACCAGCTCCATCTTGAGCTCCATGGACCCCACAGTGGACCCCTGCCATGACTTCTTCAGCTACGCCTGTGGGGGCTGGATCAAGGCCAACCCAGTCCCTGATGGCCACTCACGCTGGGGGACCTTCAGCAACCTCTGGGAACACAACCAAGCAATCATCAAGCACCTCCTCGAAAACTCCACGGCCAGCGTGAGCGAGGCAGAGAGAAAGGCGCAAGTATACTACCGTGCGTGCATGAACGAGACCAGGATCGAGGAGCTCAGGGCCAAACCTCTAATGGAGTTGATTGAGAGGCTCGGGGGCTGGAACATCACAGGTCCCTGGGCCAAGGACAACTTCCAGGACACCCTGCAGGTGGTCACCGCCCACTACCGCACCTCACCCTTCTTCTCTGTCTATGTCAGTGCCGATTCCAAGAACTCCAACAGCAACGTGATCCAGGTGGACCAGTCTGGCCTGGGCTTGCCCTCGAGAGACTATTACCTGAACAAAACTGAAAACGAGAAGGTGCTGACCGGATATCTGAACTACATGGTCCAGCTGGGGAAGCTGCTGGGCGGCGGGGACGAGGAGGCCATCCGGCCCCAGATGCAGCAGATCTTGGACTTTGAGACGGCACTGGCCAACATCACCATCCCACAGGAGAAGCGCCGTGATGAGGAGCTCATCTACCACAAAGTGACGGCAGCCGAGCTGCAGACCTTGGCACCCGCCATCAACTGGTTGCCTTTTCTCAACACCATCTTCTACCCCGTGGAGATCAATGAATCCGAGCCTATTGTGGTCTATGACAAGGAATACCTTGAGCAGATCTCCACTCTCATCAACACCACCGACAGATGCCTGCTCAACAACTACATGATCTGGAACCTGGTGCGGAAAACAAGCTCCTTCCTTGACCAGCGCTTTCAGGACGCCGATGAGAAGTTCATGGAAGTCATGTACGGGACCAAGAAGACCTGTCTTCCTCGCTGGAAGTTTTGCGTGAGTGACACAGAAAACAACCTGGGCTTTGCGTTGGGCCCCATGTTTGTCAAAGCAACCTTCGCCGAGGACAGCAAGAGCATAGCCACCGAGATCATCCTGGAGATTAAGAAGGCATTTGAGGAAAGCCTGAGCACCCTGAAGTGGATGGATGAGGAAACCCGAAAATCAGCCAAGGAAAAGGCCGATGCCATCTACAACATGATAGGATACCCCAACTTCATCATGGATCCCAAGGAGCTGGACAAAGTGTTTAATGACTACACTGCAGTTCCAGACCTCTACTTTGAAAATGCCATGCGGTTTTTCAACTTCTCATGGAGGGTCACTGCCGATCAGCTCAGGAAAGCCCCCAACAGAGATCAGTGGAGCATGACCCCGCCCATGGTGAACGCCTACTACTCGCCCACCAAGAATGAGATTGTGTTTCCGGCCGGGATCCTGCAGGCACCATTCTACACACGCTCCTCACCCAAGGCCTTAAACTTTGGTGGCATAGGTGTCGTCGTGGGCCATGAGCTGACTCATGCTTTTGATGATCAAGGACGGGAGTATGACAAGGACGGGAACCTCCGGCCATGGTGGAAGAACTCATCCGTGGAGGCCTTCAAGCGTCAGACCGAGTGCATGGTAGAGCAGTACAGCAACTACAGCGTGAACGGGGAGCCGGTGAACGGGCGGCACACCCTGGGGGAGAACATCGCCGACAACGGGGGTCTCAAGGCGGCCTATCGGGCTTACCAGAACTGGGTGAAGAAGAACGGGGCTGAGCACTCGCTCCCCACCCTGGGCCTCACCAATAACCAGCTCTTCTTCCTGGGCTTTGCACAGGTCTGGTGCTCCGTCCGCACACCTGAGAGCTCCCACGAAGGCCTCATCACCGATCCCCACAGCCCCTCTCGCTTCCGGGTCATCGGCTCCCTCTCCAATTCCAAGGAGTTCTCAGAACACTTCCGCTGCCCACCTGGCTCACCCATGAACCCGCCTCACAAGTGCGAAGTCTGGTAA

Length: 2313

View AllClose

0 Reviews

View AllClose