Human ACAD10 cDNA Clone BC126358 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL743611HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ACAD10
Gene ID:
80724
Accession #:
BC126358
Plasmid:
pUC
€1,084.00
Frequently bought together:

Description

Human ACAD10 cDNA Clone BC126358 pUC Plasmid | Cusabio

Gene Name: ACAD10

Gene ID: 80724

Accession Number: BC126358

Vector: pUC

Sequence: ATGTGTGTCAGGAGCTGTTTCCAGTCCCCCCGTCTCCAGTGGGTGTGGAGAACAGCCTTCCTGAAACACACCCAGCGCAGGCACCAGGGGTCCCACCGATGGACACACCTTGGAGGCAGCACCTACAGAGCGGTGATTTTCGACATGGGCGGAGTTCTCATTCCTTCTCCAGGGAGAGTCGCTGCAGAATGGGAGGTACAGAATCGTATCCCTTCTGGAACTATATTAAAGGCCTTGATGGAAGGTGGTGAAAATGGGCCCTGGATGAGATTTATGAGAGCAGAAATAACAGCAGAGGGTTTTTTACGAGAATTTGGGAGACTTTGCTCTGAAATGTTAAAGACCTCCGTGCCTGTGGACTCATTTTTCTCTCTGTTGACCAGTGAGCGAGTGGCAAAGCAGTTCCCAGTGATGACTGAGGCCATAACTCAAATTCGGGCAAAAGGTCTTCAGACTGCAGTCTTGAGCAATAATTTTTATCTTCCCAACCAGAAAAGCTTTTTGCCCCTGGACCGGAAACAGTTTGATGTGATTGTGGAGTCCTGCATGGAAGGGATCTGTAAGCCAGACCCTAGGATCTACAAGCTGTGCTTGGAGCAGCTCGGCCTGCAGCCCTCTGAGTCCATCTTTCTTGATGACCTTGGAACAAATCTAAAAGAAGCTGCCAGACTTGGTATTCACACCATTAAGGTTAATGACCCAGAGACTGCAGTAAAGGAATTAGAAGCTCTCTTGGGTTTTACATTGAGAGTAGGTGTTCCAAACACTCGGCCTGTGAAAAAGACGATGGAAATTCCGAAAGATTCCTTGCAGAAGTACCTCAAAGACTTACTGGGTATCCAGACCACAGGCCCATTGGAACTACTTCAGTTTGATCACGGGCAGTCAAATCCAACTTACTACATCAGGCTGGCTAATCGTGATCTAGTTCTGAGGAAGAAGCCCCCAGGGACACTCCTTCCATCTGCCCATGCCATAGAGAGGGAGTTCAGGATTATGAAAGCCCTTGCAAATGCTGGAGTACCTGTCCCTAACGTTCTTGATCTCTGTGAAGATTCAAGTGTCATTGGCACCCCCTTCTATGTGATGGAGTACTGCCCAGGTCTCATCTACAAAGACCCTTCCCTGCCAGGCTTGGAGCCCAGCCACAGACGAGCCATATACACTGCCATGAACACAGTCCTGTGCAAAATTCACAGTGTGGATCTGCAGGCTGTGGGACTTGAAGACTATGGGAAGCAAGGGGACTATATTCCACGCCAGGTACGAACCTGGGTTAAGCAGTATCGAGCTTCCGAAACTAGCACCATCCCAGCCATGGAGAGGCTGATCGAATGGCTGCCCCTCCATCTTCCCCGTCAGCAGAGGACCACAGTGGTGCACGGGGACTTCAGGCTCGACAACCTGGTGTTTCATCCAGAAGAGCCAGAGGTGCTTGCTGTCCTTGACTGGGAACTTTCTACCTTGGGCGACCCCCTTGCTGATGTGGCCTACAGCTGCCTGGCTCATTACCTGCCATCCAGTTTTCCCGTGCTGAGAGGTATTAATGACTGTGACTTGACACAGCTGGGAATCCCTGCTGCAGAGGAGTATTTCAGGATGTACTGTCTCCAAATGGGGCTCCCTCCCACTGAGAACTGGAACTTCTATATGGCTTTTTCCTTTTTCCGTGTGGCTGCAATCCTACAGGGAGTCTACAAGCGATCACTCACAGGGCAAGCAAGCTCCACATATGCGGAACAAACTGGAAAGCTGACCGAATTTGTGTCTAACCTGGCGTGGGATTTCGCAGTCAAAGAAGGGTTCCGGGTTTTCAAAGAGATGCCCTTCACAAATCCGTTAACAAGGTCCTACCACACGTGGGCCAGGCCCCAGTCCCAGTGGTGCCCCACAGGCAGCAGGAGTTATAGCTCCGTTCCAGAAGCTTCCCCAGCTCATACCTCAAGGGGAGGTCTGGTTATCTCTCCAGAGAGCCTCTCTCCACCTGTCAGAGAGCTGTATCACCGGCTGAAGCACTTCATGGAGCAACGTGTGTACCCTGCAGAGCCAGAGCTGCAGAGTCACCAGGCCTCAGCAGCCAGGTGGAGCCCCTCCCCACTGATCGAAGACCTCAAGGAGAAAGCCAAAGCTGAAGGACTTTGGAACCTTTTCCTACCCTTAGAGGCTGATCCCGAGAAAAAATACGGAGCAGGACTGACCAATGTGGAATATGCACATCTGTGTGAGCTCATGGGCACGTCCCTGTATGCCCCCGAGGTATGTAACTGCTCTGCGCCTGACACGGGCAACATGGAGCTGCTGGTGAGGTATGGCACCGAAGCGCAGAAGGCTCGCTGGCTGATTCCTCTGCTGGAGGGGAAAGCCCGCTCCTGTTTTGCTATGACCGAGCCCCAGGTTGCCTCTTCAGATGCCACCAACATTGAGGCTTCCATCAGAGAGGAGGACAGCTTCTATGTCATAAACGGTCACAAATGGTGGATCACAGGCATCCTGGATCCTCGTTGCCAACTCTGTGTGTTTATGGGAAAAACAGACCCACATGCACCAAGACACCGGCAGCAGTCTGTGCTCTTGGTTCCCATGGATACCCCAGGGATAAAAATCATCCGGCCTCTGACGGTGTATGGACTGGAAGATGCACCAGGTGGCCATGGTGAAGTCCGATTTGAGCACGTGCGTGTGCCCAAAGAGAACATGGTCCTGGGCCCTGGCCGAGGCTTTGAGATCGCCCAGGGCAGACTGGGCCCCGGCAGGATCCATCACTGCATGAGGCTGATCGGGTTCTCAGAGAGGGCCCTGGCACTCATGAAGGCCCGCGTGAAGTCCCGCTTGGCTTTTGGGAAGCCCCTGGTGGAGCAGGGCACAGTGCTGGCGGACATCGCGCAGTCGCGCGTGGAGATTGAGCAGGCACGGCTGCTGGTGCTGAGAGCTGCCCACCTCATGGACCTGGCAGGAAACAAGGCTGCAGCCTTGGATATAGCCATGATTAAAATGGTCGCCCCGTCCATGGCCTCCCGAGTGATTGATCGTGCGATTCAGGCCTTTGGAGCAGCAGGCCTGAGCAGCGACTACCCACTGGCTCAGTTCTTCACCTGGGCCCGAGCCCTGCGCTTTGCCGACGGCCCTGACGAGGTGCACCGGGCCACGGTGGCCAAGCTAGAGCTGAAGCACCGCATTTAG

Length: 3180

View AllClose

0 Reviews

View AllClose