null

Human OLFM3 cDNA Clone BC022531 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL836274HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OLFM3
Gene ID:
118427
Accession #:
BC022531
Plasmid:
pENTR223.1
$256.80
Frequently bought together:

Description

Human OLFM3 cDNA Clone BC022531 pENTR223.1 Plasmid | Cusabio

Gene Name: OLFM3

Gene ID: 118427

Accession Number: BC022531

Vector: pENTR223.1

Sequence: ATGCAGGCGACGTCCAACCTTCTCAACCTCCTGCTGCTGTCTTTGTTTGCCGGATTAGATCCTTCCAAGACTCAGATTAGTCCTAAAGAAGGGTGGCAGGTGTACAGCTCAGCTCAGGATCCTGATGGGCGGTGCATTTGTACAGTTGTTGCTCCAGAACAAAACCTGTGTTCCCGGGATGCCAAAAGCAGGCAACTTCGCAAACTACTGGAAAAGGTTCAGAACATGTCCCAGTCTATTGAAGTCTTAAACTTGAGAACTCAGAGAGATTTCCAATATGTTTTAAAAATGGAAACCCAAATGAAAGGGCTGAAGGCAAAATTTCGGCAGATTGAAGATGATCGAAAGACACTTATGACCAAGCATTTTCAGGAGTTGAAAGAGAAAATGGACGAGCTCCTGCCTTTGATCCCCGTGCTGGAACAGTACAAAACAGATGCTAAGTTAATCACCCAGTTCAAGGAGGAAATAAGGAATCTGTCTGCTGTCCTCACTGGTATTCAGGAGGAAATTGGTGCCTATGACTACGAGGAACTACACCAAAGAGTGCTGAGCTTGGAAACAAGACTTCGTGACTGCATGAAAAAGCTAACATGTGGCAAACTGATGAAAATCACAGGCCCAGTTACAGTCAAGACATCTGGAACCCGATTTGGTGCTTGGATGACAGACCCTTTAGCATCTGAGAAAAACAACAGAGTCTGGTACATGGACAGTTATACTAACAATAAAATTGTTCGTGAATACAAATCAATTGCAGACTTTGTCAGTGGGGCTGAATCAAGGACATACAACCTTCCTTTCAAGTGGGCAGGAACTAACCATGTTGTCTACAATGGCTCACTCTATTTTAACAAGTATCAGAGTAATATCATCATCAAATACAGCTTTGATATGGGGAGAGTGCTTGCCCAACGAAGCCTGGAGTATGCTGGTTTTCATAATGTTTACCCCTACACATGGGGTGGATTCTCTGACATCGACCTAATGGCTGATGAAATCGGGCTGTGGGCTGTGTATGCAACTAACCAGAATGCAGGCAATATTGTCATCAGCCAACTTAACCAAGATACCTTGGAGGTGATGAAGAGCTGGAGCACTGGCTACCCCAAGAGAAGTGCAGGGGAATCTTTCATGATCTGTGGGACACTGTATGTCACCAACTCCCACTTAACTGGAGCCAAGGTGTATTATTCCTATTCCACCAAAACCTCCACATATGAGTACACAGACATTCCCTTCCATAACCAATACTTTCACATATCCATGCTTGACTACAATGCAAGAGATCGAGCTCTCTGTGCCTGGAACAATGGCCACCAGGTGCTGTTCAATGTCACCCTTTTCCATATCATCAAGACAGAGGATGACACATAG

Length: 1377

View AllClose

0 Reviews

View AllClose