Human EHHADH cDNA Clone BC038948 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL600104HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EHHADH
Gene ID:
1962
Accession #:
BC038948
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EHHADH cDNA Clone BC038948 pENTR223.1 Plasmid | Cusabio

Gene Name: EHHADH

Gene ID: 1962

Accession Number: BC038948

Vector: pENTR223.1

Sequence: ATGGCCGAGTATACGCGGCTGCACAACGCCTTGGCGCTAATCCGCCTCCGAAACCCGCCGGTCAACGCGATCAGTACGACTTTACTCCGTGACATAAAAGAAGGACTACAGAAAGCTGTAATAGACCATACAATAAAAGCCATTGTGATTTGTGGAGCAGAGGGCAAATTTTCTGCAGGTGCTGATATTCGTGGCTTCAGTGCTCCTAGGACATTTGGCCTTACACTGGGACATGTAGTAGATGAAATACAGAGAAATGAGAAGCCCGTGGTGGCAGCAATCCAAGGCATGGCTTTCGGAGGGGGACTAGAGCTGGCCCTGGGCTGTCACTATAGGATTGCCCACGCAGAGGCTCAAGTTGGCTTACCAGAAGTTACACTGGGACTTCTCCCTGGTGCAAGAGGAACCCAGCTTCTCCCCAGACTCACTGGAGTTCCTGCTGCACTTGACTTAATTACCTCAGGAAGACGTATTTTAGCAGATGAAGCACTCAAGCTGGGCATTCTAGATAAAGTTGTAAACTCAGACCCGGTTGAAGAAGCAATCAGATTTGCTCAGAGAGTTTCAGATCAACCTCTAGAATCCCGTAGACTCTGCAACAAGCCAATTCAGAGCTTGCCCAACATGGACAGCATTTTTAGTGAGGCCCTCTTGAAGATGCGGAGGCAGCACCCTGGGTGTCTTGCACAGGAGGCTTGTGTCCGTGCAGTCCAGGCTGCTGTGCAGTATCCCTATGAAGTGGGCATCAAGAAGGAGGAGGAGCTGTTTCTATATCTTTTGCAATCAGGGCAGGCTAGAGCCCTGCAATATGCTTTCTTCGCTGAAAGGAAAGCAAATAAGTGGTCAACTCCCTCCGGAGCATCGTGGAAAACAGCATCAGCGCGGCCTGTCTCCTCAGTTGGTGTTGTTGGCTTGGGAACAATGGGCCGAGGCATTGTCATTTCTTTTGCAAGGGCCAGGATTCCTGTGATTGCTGTAGACTCGGACAAAAACCAGCTAGCAACTGCAAACAAGATGATAACCTCTGTCTTGGAAAAAGAAGCCTCCAAAATGCAACAGAGCGGCCACCCTTGGTCAGGACCAAAACCCAGGTTAACTTCATCTGTGAAGGAGCTTGGTGGTGTAGATTTAGTCATTGAAGCAGTATTTGAGGAAATGAGCCTGAAGAAGCAGGTCTTTGCTGAACTCTCAGCTGTGTGCAAACCAGAAGCATTTTTGTGCACTAATACTTCAGCCCTGGATGTTGATGAGATTGCTTCTTCCACTGATCGTCCTCACTTGGTCATTGGCACCCACTTCTTTTCGCCAGCTCATGTCATGAAGTTGTTAGAGGTTATTCCCAGCCAATACTCTTCCCCCACTACCATTGCCACTGTTATGAACTTATCAAAAAAGATTAAAAAGATTGGAGTCGTTGTAGGCAACTGTTTTGGATTTGTGGGGAATCGAATGTTGAATCCTTACTACAATCAGGCATATTTCTTGTTAGAAGAAGGCAGCAAACCAGAGGAGGTAGATCAGGTGCTGGAAGAGTTTGGTTTTAAAATGGGACCTTTTAGAGTGTCTGATCTTGCTGGGTTGGATGTGGGCTGGAAATCTAGAAAGGGGCAAGGTCTTACTGGACCTACATTGCTTCCAGGAACTCCTGCCCGAAAAAGGGGTAATAGGAGGTACTGCCCAATTCCTGATGTGCTCTGTGAATTAGGACGATTTGGCCAGAAGACAGGTAAGGGTTGGTATCAATATGACAAGCCATTGGGTAGGATTCACAAACCTGATCCCTGGCTTTCCAAATTCCTATCACGGTATAGAAAAACCCATCACATTGAACCACGTACCATTAGCCAGGATGAGATCCTTGAACGCTGCTTATATTCACTTATCAATGAAGCATTCCGTATCTTGGGAGAAGGGATAGCTGCTAGCCCAGAGCACATTGATGTTGTCTATTTACATGGATATGGATGGCCAAGGCACAAGGGCGGGCCCATGTTCTATGCTTCCACAGTTGGGTTGCCCACAGTTCTAGAGAAATTGCAGAAATATTACAGGCAGAACCCTGATATTCCCCAACTGGAGCCAAGTGACTATCTAAAAAAACTGGCTTCTCAGGGAAACCCTCCCCTGAAAGAATGGCAAAGCTTGGCAGGCTCCCCTAGCAGTAAATTGTGA

Length: 2172

View AllClose

0 Reviews

View AllClose