Human OGFR cDNA Clone BC032666 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016311HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGFR
Gene ID:
11054
Accession #:
BC032666
Plasmid:
pUC
€616.00
Frequently bought together:

Description

Human OGFR cDNA Clone BC032666 pUC Plasmid | Cusabio

Gene Name: OGFR

Gene ID: 11054

Accession Number: BC032666

Vector: pUC

Sequence: ATGCGGAGGACGCGGAGGACGAGGACTGCGAGGACGGCGAGGCCGCCGGCGCGAGGGACGCGGACGCAGGGGACGAGGACGAGGAGTCGGAGGAGCCGCGGGCGGCGCGGCCCAGCTCGTTCCAGAATGACAGGGTCCAGAAACTGGCGAGCCACGAGGGACATGTGTAGGTATCGGCACAACTATCCGGATCTGGTGGAACGAGACTGCAATGGGGACACGCCAAACCTGAGTTTCTACAGAAATGAGATCCGCTTCCTGCCCAACGGCTGTTTCATTGAGGACATTCTTCAGAACTGGACGGACAACTATGACCTCCTTGAGGACAATCACTCCTACATCCAGTGGCTGTTTCCTCTGCGAGAACCAGGAGTGAACTGGCATGCCAAGCCCCTCACGCTCAGGGAGGTCGAGGTGTTTAAAAGCTCCCAGGAGATCCAGGAGCGGCTTGTCCGGGCCTACGAGCTCATGCTGGGCTTCTACGGGATCCGGCTGGAGGACCGAGGCACGGGCACGGTGGGCCGAGCACAGAACTACCAGAAGCGCTTCCAGAACCTGAACTGGCGCAGCCACAACAACCTCCGCATCACACGCATCCTCAAGTCGCTGGGTGAGCTAGGCCTCGAGCACTTCCAGGCGCCACTGGTCCGCTTCTTCCTGGAGGAGACGCTGGTGCGGCGGGAGCTGCCGGGGGTGCGGCAGAGTGCCCTGGACTACTTCATGTTCGCCGTGCGCTGCCGACACCAGCGCCGCCAGCTGGTGCACTTCGCCTGGGAGCACTTCCGGCCCCGCTGCAAGTTCGTCTGGGGGCCCCAAGACAAGCTGCGGAGGTTCAAGCCCAGCTCTCTGCCGCATCCGCTCGAGGGCTCCAGGAAGGTGGAGGAGGAAGGAAGCCCCGGGGACCCCGACCACGAGGCCAGCACCCAGGGTCGGACCTGTGGGCCAGAGCATAGCAAGGGTGGGGGCAGGGTGGACGAGGGGCCCCAGCCACGGAGCGTGGAGCCCCAGGATGCGGGACCCCTGGAGAGGAGCCAGGGGGATGAGGCAGGGGGCCACGGGGAAGATAGGCCGGAGCCCTTAAGCCCCAAAGAGAGCAAGAAGAGGAAGCTGGAGCTGAGCCGGCGGGAGCAGCCGCCCACAGAGCCAGGCCCTCAGAGTGCCTCAGAGGTGGAGAAGATCGCTCTGAATTTGGAGGGGTGTGCCCTCAGCCAGGGAAGCCTCAGGACGGGGACCCAGGAAGTGGGCGGTCAGGACCCTGGGGAGGCAGTGCAGCCCTGCCGCCAACCCCTGGGAGCCAGGGTGGCCGACAAGGTGAGGAAGCGGAGGAAGGTGGATGAGGGTGCTGGGGACAGTGCTGCGGTGGCCAGTGGTGGTGCCCAGACCTTGGCCCTTGCCGGGTCCCCTGCCCCATCGGGGCACCCCAAGGCTGGACACAGTGAGAACGGGGTTGAGGAGGACACAGAAGGTCGAACGGGGCCCAAAGAAGGTACCCCTGGGAGCCCATCGGAGACCCCAGGCCCCAGCCCAGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCAGCAGGACCTGCAGGGGACGAGCCGGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCAGCAGGACCTGCAGGGGACGAGCCAGCCAAGACCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAGGGATGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCGGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCGGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAGGGATGAGCCAGCCAAGGCGGGGGAGGCAGCAGAGTTGCAGGACGCAGAGGTGGAGTCTTCTGCCAAGTCTGGGAAGCCTTAA

Length: 1983

View AllClose

0 Reviews

View AllClose