Human OGFR cDNA Clone BC014137 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016311HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OGFR
Gene ID:
11054
Accession #:
BC014137
Plasmid:
pUC
€613.00
Frequently bought together:

Description

Human OGFR cDNA Clone BC014137 pUC Plasmid | Cusabio

Gene Name: OGFR

Gene ID: 11054

Accession Number: BC014137

Vector: pUC

Sequence: ATGGACGACCCCGACTGCGACTCCACCTGGGAGGAGGACGAGGAGGATGCGGAGGACGCGGAGGACGAGGACTGCGAGGACGGCGAGGCCGCCGGCGCGAGGGACGCGGACGCAGGGGACGAGGACGAGGAGTCGGAGGAGCCGCGGGCGGCGCGGCCCAGCTCGTTCCAGTCCAGAATGACAGGGTCCAGAAACTGGCGAGCCACGAGGGACATGTGTAGGTATCGGCACAACTATCCGGATCTGGTGGAACGAGACTGCAATGGGGACACGCCAAACCTGAGTTTCTACAGAAATGAGATCCGCTTCCTGCCCAACGGCTGTTTCATTGAGGACATTCTTCAGAACTGGACGGACAACTATGACCTCCTTGAGGACAATCACTCCTACATCCAGTGGCTGTTTCCTCTGCGAGAACCAGGAGTGAACTGGCATGCCAAGCCCCTCACGCTCAGGGAGGTCGAGGTGTTTAAAAGCTCCCAGGAGATCCAGGAGCGGCTTGTCCGGGCCTACGAGCTCATGCTGGGCTTCTACGGGATCCGGCTGGAGGACCGAGGCACGGGCACGGTGGGCCGAGCACAGAACTACCAGAAGCGCTTCCAGAACCTGAACTGGCGCAGCCACAACAACCTCCGCATCACACGCATCCTCAAGTCGCTGGGTGAGCTGGGCCTCGAGCACTTCCAGGCGCCGCTGGTCCGCTTCTTCCTGGAGGAGACGCTGGTGCGGCGGGAGCTGCCGGGGGTGCGGCAGAGTGCCCTGGACTACTTCATGTTCGCCGTGCGCTGCCGACACCAGCGCCGCCAGCTGGTGCACTTCGCCTGGGAGCACTTCCGGCCCCGCTGCAAGTTCGTCTGGGGGCCCCAAGACAAGCTGCGGAGGTTCAAGCCCAGCTCTCTGCCCCATCCGCTCGAGGGCTCCAGGAAGGTGGAGGAGGAAGGAAGCCCCGGGGACCCCGACCACGAGGCCAGCACCCAGGGTCGGACCTGTGGGCCAGAGCATAGCAAGGGTGGGGGCAGGGTGGACGAGGGGCCCCAGCCACGGAGCGTGGAGCCCCAGGATGCGGGACCCCTGGAGAGGAGCCAGGGGGATGAGGCAGGGGGCCACGGGGAAGATAGGCCGGAGCCCTTAAGCCCCAAAGAGAGCAAGAAGAGGAAGCTGGAGCTGAGCCGGCGGGAGCAGCCGCCCACAGAGCCAGGCCCTCAGAGTGCCTCAGAGGTGGAGAAGATCGCTCTGAATTTGGAGGGGTGTGCCCTCAGCCAGGGCAGCCTCAGGACGGGGACCCAGGAAGTGGGCGGTCAGGACCCTGGGGAGGCAGTGCAGCCCTGCCGCCAACCCCTGGGAGCCAGGGTGGCCGACAAGGTGAGGAAGCGGAGGAAGGTGGATGAGGGTGCTGGGGACAGTGCTGCGGTGGCCAGTGGTGGTGCCCAGACCTTGGCCCTTGCCGGGTCCCCTGCCCCATCGGGGCACCCCAAGGCTGGACACAGTGAGAACGGGGTTGAGGAGGACACAGAAGGTCGAACGGGGCCCAAAGAAGGTACCCCTGGGAGCCCATCGGAGACCCCAGGCCCCAGCCCAGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCAGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAGGGATGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCAGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCCGCCCGGCAGGACCTGCAGGGGACGAGCCAGCCGAGAGCCCATCGGAGACCCCAGGCCCCAGCCCGGCAGGACCTACAAGGGATGAGCCAGCCAAGGCGGGGGAGGCAGCAGAGTTGCAGGACGCAGAGGTGGAGTCTTCTGCCAAGTCTGGGAAGCCTTAA

Length: 1974

View AllClose

0 Reviews

View AllClose