Human OAT cDNA Clone BC016928 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016242HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAT
Gene ID:
4942
Accession #:
BC016928
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human OAT cDNA Clone BC016928 pENTR223.1 Plasmid | Cusabio

Gene Name: OAT

Gene ID: 4942

Accession Number: BC016928

Vector: pENTR223.1

Sequence: ATGTTTTCCAAACTAGCACATTTGCAGAGGTTTGCTGTACTTAGTCGCGGAGTTCATTCTTCAGTGGCTTCTGCTACATCTGTTGCAACTAAAAAAACAGTCCAAGGCCCTCCAACCTCTGATGACATTTTTGAAAGGGAATATAAGTATGGTGCACACAACTACCATCCTTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATTTACTTATGGGATGTAGAAGGCAGAAAATATTTTGACTTCCTGAGTTCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCCAAGATTGTGAATGCTCTGAAGAGTCAAGTGGACAAATTGACCTTAACATCTAGAGCTTTCTATAATAACGTACTTGGTGAATATGAGGAGTATATTACTAAACTTTTCAACTACCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCCTGTAAACTAGCTCGTAAGTGGGGCTATACCGTGAAGGGCATTCAGAAATACAAAGCAAAGATTGTTTTTGCAGCTGGGAACTTCTGGGGTAGGACGTTGTCTGCTATCTCCAGTTCCACAGACCCAACCAGTTACGATGGTTTTGGACCATTTATGCCGGGATTCGACATCATTCCCTATAATGATCTGCCCGCACTGGAGCGTGCTCTTCAGGATCCAAATGTGGCTGCGTTCATGGTAGAACCAATTCAGGGTGAAGCAGGCGTTGTTGTTCCGGATCCAGGTTACCTAATGGGAGTGCGAGAGCTCTGCACCAGGCACCAGGTTCTCTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAGATGGCTGGCTGTTGATTATGAAAATGTCAGACCTGATATAGTCCTCCTTGGAAAGGCCCTTTCTGGGGGCTTATACCCTGTGTCTGCAGTGCTGTGTGATGATGACATCATGCTGACCATTAAGCCAGGGGAGCATGGGTCCACATACGGTGGCAATCCACTAGGCTGCCGAGTGGCCATCGCAGCCCTTGAGGTTTTAGAAGAAGAAAACCTTGCTGAAAATGCAGACAAATTGGGCATTATCTTGAGAAATGAACTCATGAAGCTACCTTCTGATGTTGTAACTGCCGTAAGAGGAAAAGGATTATTAAACGCTATTGTCATTAAAGAAACCAAAGATTGGGATGCTTGGAAGGTGTGTCTACGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCATGGCGACATTATCAGGTTTGCGCCTCCGCTGGTGATCAAGGAGGATGAGCTTCGAGAGTCCATTGAAATTATTAACAAGACCATCTTGTCTTTCTGA

Length: 1320

View AllClose

0 Reviews

View AllClose