Human OAT cDNA Clone BC000964 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016242HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OAT
Gene ID:
4942
Accession #:
BC000964
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OAT cDNA Clone BC000964 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OAT

Gene ID: 4942

Accession Number: BC000964

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTTTCCAAACTAGCACATTTGCAGAGGTTTGCTGTACTTAGTCGCGGAGTTCATTCTTCAGTGGCTTCTGCTACATCTGTTGCAACTAAAAAAACAGTCCAAGGCCCTCCAACCTCTGATGACATTTTTGAAAGGGAATATAAGTATGGTGCACACAACTACCATCCTTTACCTGTAGCCCTGGAGAGAGGAAAAGGTATTTACTTATGGGATGTAGAAGGCAGAAAATATTTTGACTTCCTGAGTTCTTACAGTGCTGTCAACCAAGGGCATTGTCACCCCAAGATTGTGAATGCTCTGAAGAGTCAAGTGGACAAATTGACCTTAACATCTAGAGCTTTCTATAATAACGTACTTGGTGAATATGAGGAGTATATTACTAAACTTTTCAACTACCACAAAGTTCTTCCTATGAATACAGGAGTGGAGGCTGGAGAGACTGCCTGTAAACTAGCTCGTAAGTGGGGCTATACCGTGAAGGGCATTCAGAAATACAAAGCAAAGATTGTTTTTGCAGCTGGGAACTTCTGGGGTAGGACGTTGTCTGCTATCTCCAGTTCCACAGACCCAACCAGTTACGATGGTTTTGGACCATTTATGCCGGGATTCGACATCATTCCCTATAATGATCTGCCCGCACTGGAGCGTGCTCTTCAGGATCCAAATGTGGCTGCGTTCATGGTAGAACCAATTCAGGGTGAAGCAGGCGTTGTTGTTCCGGATCCAGGTTACCTAATGGGAGTGCGAGAGCTCTGCACCAGGCACCAGGTTCTCTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAGATGGCTGGCTGTTGATTATGAAAATGTCAGACCTGATATAGTCCTCCTTGGAAAGGCCCTTTCTGGGGGCTTATACCCTGTGTCTGCAGTGCTGTGTGATGATGACATCATGCTGACCATTAAGCCAGGGGAGCATGGGTCCACATACGGTGGCAATCCACTAGGCTGCCGAGTGGCCATCGCAGCCCTTGAGGTTTTAGAAGAAGAAAACCTTGCTGAAAATGCAGACAAATTGGGCATTATCTTGAGAAATGAACTCATGAAGCTACCTTCTGATGTTGTAACTGCCGTAAGAGGAAAAGGATTATTAAATGCTATTGTCATTAAAGAAACCAAAGATTGGGATGCTTGGAAGGTGTGTCTACGACTTCGAGATAATGGACTTCTGGCCAAGCCAACCCATGGCGACATTATCAGGTTTGCGCCTCCGCTGGTGATCAAGGAGGATGAGCTTCGAGAGTCCATTGAAATTATTAACAAGACCATCTTGTCTTTCTGA

Length: 1320

View AllClose

0 Reviews

View AllClose