Human LAS1L cDNA Clone BC014545 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL897285HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAS1L
Gene ID:
81887
Accession #:
BC014545
Plasmid:
pUC
€673.00
Frequently bought together:

Description

Human LAS1L cDNA Clone BC014545 pUC Plasmid | Cusabio

Gene Name: LAS1L

Gene ID: 81887

Accession Number: BC014545

Vector: pUC

Sequence: ATGTCGTGGGAATCCGGGGCCGGGCCAGGTCTAGGTTCCCAGGGGATGGATCTCGTGTGGAGTGCGTGGTACGGAAAGTGCGTTAAAGGGAAAGGGTCGTTGCCACTCTCGGCCCACGGCATCGTGGTCGCCTGGCTCAGCAGGGCCGAGTGGGACCAGGTGACGGTTTATCTGTTCTGTGACGACCATAAGTTGCAGCGGTACGCGCTTAACCGCATCACGGTGTGGAGGAGCAGGTCAGGCAACGAACTCCCTCTGGCAGTGGCTTCTACTGCTGACCTGATACGCTGTAAGCTCTTGGATGTAACTGGTGGCTTGGGCACTGATGAACTTAGACTGCTCTATGGCATGGCATTGGTCAGGTTTGTGAATCTTATCTCAGAGAGGAAGACAAAGTTTGCCAAGGTCCCCCTCAAGTGTCTGGCTCAAGAGGTAAATATTCCGGATTGGATTGTTGACCTTCGCCATGAGTTGACCCACAAGAAAATGCCCCATATAAATGACTGCCGCAGAGGCTGCTACTTTGTCCTGGATTGGCTCCAGAAGACCTATTGGTGCCGCCAACTGGAGAACAGCCTGAGAGAGACCTGGGAGTTGGAGGAGTTCAGGGAAGGGATAGAGGAAGAGGATCAAGAGGAAGATAAGAACATTGTTGTTGATGACATCACAGAACAGAAACCAGAGCCTCAGGATGATGGGAAAAGTACGGAGTCAGATGTAAAGGCCGATGGAGACAGCAAAGGCAGCGAAGAGGTGGATTCTCATTGCAAAAAGGCCCTGAGTCATAAAGAGCTATATGAAAGAGCCCGAGAACTGCTGGTATCATACGAAGAGGAGCAGTTTACGGTGCTGGAGAAATTTAGGTATTTACCTAAGGCCATTAAGGCGTGGAATAACCCGTCCCCACGTGTAGAATGTGTCCTGGCAGAGCTCAAGGGCGTTACATGCGAGAACAGGGAGGCTGTGCTGGATGCTTTTCTGGATGATGGCTTCCTTGTCCCCACATTTGAACAGTTGGCAGCTTTGCAGATAGAATATGAAGATGGTCAGACTGAGGTCCAGAGAGGGGAAGGTACTGACCCAAAGTCACACAAAAACGTGGACTTGAATGACGTCCTGGTGCCAAAGCCGTTCTCTCAGTTCTGGCAGCCCCTGCTCAGGGGCCTGCACTCCCAGAACTTCACGCAGGCCCTATTGGAGAGGATGCTCTCTGAACTGCCAGCCTTGGGGATCAGCGGGATCCGGCCTACCTACATCCTCAGATGGACCGTTGAACTGATCGTGGCCAACACCAAGACTGGACGGAATGCTCGCCGATTTTCTGCAGGCCAGTGGGAAGCAAGAAGGGGCTGGAGGCTGTTCAACTGCTCCGCCTCCCTTGACTGGCCCCGGATGGTTGAGTCCTGCTTGGGCTCACCTTGCTGGGCCAGCCCCCAACTCCTTCGGATCATCTTCAAAGCCATGGGGCAGGGCCTGCCAGACGAGGAGCAGGAGAAGCTGCTGCGCATCTGTTCCATTTATACCCAGAGTGGAGAAAACAGCCTGGTGCAGGAGGGCTCTGAGGCCTCCCCCATTGGGAAGTCTCCATATACACTAGACAGCCTGTATTGGAGCGTCAAGCCAGCCAGCTCCAGCTTCGGGTCTGAAGCAAAGGCCCAGCAACAGGAGGAGCAGGGCAGTGTTAATGATGTCAAGGAAGAGGAGAAGGAGGAGAAAGAGGTCTTGCCAGACCAGGTAGAGGAGGAGGAAGAAAATGATGACCAAGAGGAGGAAGAGGAGGATGAAGATGATGAAGATGATGAAGAGGAAGACAGAATGGAGGTGGGGCCTTTCTCTACAGGGCAAGAGTCCCCCACTGCCGAGAATGCTAGGCTTCTGGCCCAGAAAAGAGGAGCTTTGCAGGGCTCTGCATGGCAGGTTAGCTCAGAAGACGTGCGATGGGACACATTTCCCCTAGGCCGAATGCCAGGTCAGACCGAGGACCCAGCAGAGCTCATGCTGGAGAATTATGACACCATGTATCTTTTGGACCAGCCTGTGCTAGAGCAGCGGCTGGAACCCTCAACATGCAAGACTGACACCTTGGGCCTGAGCTGTGGTGTCGGCAGTGGCAACTGCAGCAACAGCAGCAGCAGCAACTTCGAGGGCCTTCTCTGGAGCCAGGGGCAGCTGCATGGGCTCAAAACTGGCCTGCAGCTCTTCTGA

Length: 2205

View AllClose

0 Reviews

View AllClose