Human LAS1L cDNA Clone BC018610 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL897285HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LAS1L
Gene ID:
81887
Accession #:
BC018610
Plasmid:
pUC
€660.00
Frequently bought together:

Description

Human LAS1L cDNA Clone BC018610 pUC Plasmid | Cusabio

Gene Name: LAS1L

Gene ID: 81887

Accession Number: BC018610

Vector: pUC

Sequence: ATGTCGTGGGAATCCGGGGCCGGGCCAGGTCTAGGTTCCCAGGGGATGGATCTCGTGTGGAGTGCGTGGTACGGAAAGTGCGTTAAAGGGAAAGGGTCGTTGCCACTCTCGGCCCACGGCATCGTGGTCGCCTGGCTCAGCAGGGCCGAGTGGGACCAGGTGACGGTTTATCTGTTCTGTGACGACCATAAGTTGCAGCGGTACGCGCTTAACCGCATCACGGTGTGGAGGAGCAGGTCAGGCAACGAACTCCCTCTGGCAGTGGCTTCTACTGCTGACCTGATACGCTGTAAGCTCTTGGATGTAACTGGTGGCTTGGGCACTGATGAACTTAGACTGCTCTATGGCATGGCATTGGTCAGGTTTGTGAATCTTATCTCAGAGAGGAAGACAAAGTTTGCCAAGGTCCCCCTCAAGTGTCTGGCTCAAGAGGTAAATATTCCGGATTGGATTGTTGACCTTCGCCATGAGTTGACCCACAAGAAAATGCCCCATATAAATGACTGCCGCAGAGGCTGCTACTTTGTCCTGGATTGGCTCCAGAAGACCTATTGGTGCCGCCAACTGGAGAACAGCCTGAGAGAGACCTGGGAGTTGGAGGAGTTCAGGGAAGGGATAGAGGAAGAGGATCAAGAGGAAGATAAGAACATTGTTGTTGATGACATCACAGAACAGAAACCAGAGCCTCAGGATGATGGGAAAAGTACGGAGTCAGATGTAAAGGCCGATGGAGACAGCAAAGGCAGCGAAGAGGTGGATTCTCATTGCAAAAAGGCCCTGAGTCATAAAGAGCTATATGAAAGAGCCCGAGAACTGCTGGTATCATACGAAGAGGAGCAGTTTACGGTGCTGGAGAAATTTAGGTATTTACCTAAGGCCATTAAGGCGTGGAATAACCCGTCCCCACGTGTAGAATGTGTCCTGGCAGAGCTCAAGGGCGTTACATGCGAGAACAGGGAGGCTGTGCTGGATGCTTTTCTGGATGATGGCTTCCTTGTCCCCACATTTGAACAGTTGGCAGCTTTGCAGATAGAATATGAAGAAAACGTGGACTTGAATGACGTCCTGGTGCCAAAGCCGTTCTCTCAGTTCTGGCAGCCCCTGCTCAGGGGCCTGCACTCCCAGAACTTCACGCAGGCCCTATTGGAGAGGATGCTCTCTGAACTGCCAGCCTTGGGGATCAGCGGGATCCGGCCTACCTACATCCTCAGATGGACCGTTGAACTGATCGTGGCCAACACCAAGACTGGACGGAATGCTCGCCGATTTTCTGCAGGCCAGTGGGAAGCAAGAAGGGGCTGGAGGCTGTTCAACTGCTCCGCCTCCCTTGACTGGCCCCGGATGGTTGAGTCCTGCTTGGGCTCACCTTGCTGGGCCAGCCCCCAACTCCTTCGGATCATCTTCAAAGCCATGGGGCAGGGCCTGCCAGACGAGGAGCAGGAGAAGCTGCTGCGCATCTGTTCCATTTATACCCAGAGTGGAGAAAACAGCCTGGTGCAGGAGGGCTCTGAGGCCTCCCCCATTGGGAAGTCTCCATATACACTAGACAGCCTGTATTGGAGCGTCAAGCCAGCCAGCTCCAGCTTCGGGTCTGAAGCAAAGGCCCAGCAACAGGAGGAGCAGGGCAGTGTTAATGATGTCAAGGAAGAGGAGAAGGAGGAGAAAGAGGTCTTGCCAGACCAGGTAGAGGAGGAGGAAGAAAATGATGACCAAGAGGAGGAAGAGGAGGATGAAGATGATGAAGATGATGAAGAGGAAGACAGAATGGAGGTGGGGCCTTTCTCTACAGGGCAAGAGTCCCCCACTGCCGAGAATGCTAGGCTTCTGGCCCAGAAAAGAGGAGCTTTGCAGGGCTCTGCATGGCAGGTTAGCTCAGAAGACGTGCGATGGGACACATTTCCCCTAGGCCGAATGCCAGGTCAGACCGAGGACCCAGCAGAGCTCATGCTGGAGAATTATGACACCATGTATCTTTTGGACCAGCCTGTGCTAGAGCAGCGGCTGGAACCCTCAACATGCAAGACTGACACCTTGGGCCTGAGCTGTGGTGTCGGCAGTGGCAACTGCAGCAACAGCAGCAGCAGCAACTTCGAGGGCCTTCTCTGGAGCCAGGGGCAGCTGCATGGGCTCAAAACTGGCCTGCAGCTCTTCTGA

Length: 2154

View AllClose

0 Reviews

View AllClose