Human LARP1 cDNA Clone BC010144 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL740795HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARP1
Gene ID:
23367
Accession #:
BC010144
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human LARP1 cDNA Clone BC010144 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: LARP1

Gene ID: 23367

Accession Number: BC010144

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTTAGGAGTTAATGTTGCAAAGAGTAGTTTACATCTTCACTTTCTGAAGACACTTGAATTTAGGACCGATGTATCTGTGACAAGCATGCCAGAAGTGGCAGGGGCCATCAGGGCTAACCACTTCACACCTACCATCGTCCCATGGGGATCCAAGACCTGA

Length: 162

View AllClose

0 Reviews

View AllClose