Human LARP1 cDNA Clone BC001460 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL740795HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
LARP1
Gene ID:
23367
Accession #:
BC001460
Plasmid:
pUC
€1,047.00
Frequently bought together:

Description

Human LARP1 cDNA Clone BC001460 pUC Plasmid | Cusabio

Gene Name: LARP1

Gene ID: 23367

Accession Number: BC001460

Vector: pUC

Sequence: ATGCTTTGGAGGGTGCTTTTGTCAAAGAGGCCTCCTTTCCCTCACCCAGAGCTGGATTTCCAAGAGGCTCCCATACCTAGCTGCCCTGGCAGACTCCCAGGGAGGAAAAACAGCGTGGCCTTGGCAGCTGCCCCGAGGAAGGAGCCCACAGGTGACAGGGAGAAGCCATTGCCATTCCCTGTCCTGGCCCCCTTCAGCAACCCTGAACACTCTGCTCCAGCCAAGGTGGTGAGGGCAGCTGTTCCTAAACAGCGCAAAGGCAGCAAGGTTGGTGACTTTGGAGATGCAATCAATTGGCCCACACCTGGAGAGATAGCCCACAAGAGTGTTCAGCCACAGTCCCACAAGCCTCAGCCTACCCGTAAACTGCCACCCAAGAAGGACATGAAGGAACAGGAGAAAGGAGAAGGGAGTGATAGTAAGGAGAGTCCAAAAACCAAATCAGATGAATCAGGGGAGGAAAAGAATGGAGATGAGGATTGCCAGCGAGGCGGGCAGAAGAAGAAAGGAAACAAACACAAGTGGGTTCCATTACAAATAGACATGAAGCCTGAAGTGCCCAGAGAGAAACTGGCTTCACGCCCCACTCGCCCACCGGAGCCTAGACACATACCTGCCAATCGCGGAGAGATCAAAGGGTCTGAGTCTGCCACCTACGTGCCCGTGGCCCCCCCCACCCCAGCCTGGCAACCAGAGATCAAACCGGAGCCTGCCTGGCACGACCAGGATGAGACATCGAGTGTGAAGAGTGATGGGGCTGGTGGGGCGCGGGCTTCCTTCCGTGGCCGTGGACGGGGGCGTGGTCGCGGCCGGGGACGCGGCCGGGGTGGCACTCGAACCCATTTTGACTACCAGTTTGGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGCTTCTCAACTGCCCTGAATTTGTTCCCCGTCAGCACTACCAAAAGGAGACAGAGTCGGCACCTGGCTCTCCTCGTGCAGTCACCCCAGTGCCAACCAAAACAGAGGAGGTCAGCAACCTAAAGACACTACCCAAGGGCCTGTCTGCCAGCCTGCCTGACCTGGATTCTGAGAACTGGATTGAAGTGAAGAAGAGGCCTCGGCCATCCCCAGCACGGCCCAAGAAGTCAGAGGAGTCCAGATTTTCCCACCTGACCTCCCTGCCTCAGCAGCTGCCTTCCCAGCAGCTGATGTCCAAGGATCAGGATGAGCAAGAGGAACTGGATTTTCTGTTTGACGAGGAGATGGAGCAGATGGATGGGCGGAAGAACACCTTCACTGCCTGGTCTGATGAGGAATCTGACTATGAGATTGATGACAGGGATGTCAACAAGATCCTCATTGTCACCCAGACACCACATTACATGCGCCGGCACCCAGGGGGGGACCGCACAGGCAACCACACCTCGCGTGCCAAGATGAGCGCCGAACTGGCCAAGGTCATTAATGATGGCCTCTTCTACTATGAGCAGGACCTGTGGGCTGAAAAGTTTGAACCTGAGTATTCCCAGATCAAGCAAGAAGTCGAGAACTTCAAAAAGGTCAATATGATCAGCCGGGAGCAGTTTGACACACTGACCCCTGAGCCCCCTGTGGATCCCAACCAGGAAGTTCCTCCTGGGCCACCTCGGTTCCAGCAAGTTCCTACGGATGCCCTGGCCAACAAGTTGTTTGGTGCTCCTGAGCCCTCCACCATCGCCCGCTCTCTACCAACCACTGTCCCAGAGTCACCAAACTACCGCAACACCAGGACCCCTCGCACTCCCCGGACACCACAGCTCAAAGACTCAAGCCAGACATCACGGTTTTACCCAGTGGTGAAAGAAGGACGGACACTGGATGCCAAGATGCCTCGAAAAAGAAAGACAAGACACAGTTCAAACCCACCCTTGGAGAGCCATGTGGGCTGGGTGATGGATTCCCGTGAGCACAGGCCCCGTACTGCTTCCATCAGCTCCAGCCCCTCAGAAGGGACGCCTACAGTTGGCAGCTATGGCTGTACCCCTCAGTCATTGCCCAAGTTCCAGCATCCTTCCCATGAACTGCTCAAGGAAAATGGCTTCACACAACACGTCTACCATAAGTATCGTAGGCGCTGCCTTAATGAGCGGAAACGCTTGGGCATTGGCCAGTCTCAGGAGATGAACACACTCTTCCGCTTCTGGTCCTTCTTCCTCCGAGATCACTTCAACAAAAAGATGTATGAGGAGTTCAAGCAGCTGGCTCTGGAGGACGCCAAAGAAGGCTACAGATATGGTTTGGAGTGCCTTTTTCGATACTACAGTTATGGCCTGGAAAAGAAGTTCCGGCTGGACATATTCAAGGATTTTCAGGAGGAAACGGTGAAGGACTATGAAGCTGGCCAACTGTATGGGCTGGAGAAGTTCTGGGCCTTCTTGAAATATTCCAAAGCCAAAAATTTGGACATTGACCCCAAACTGCAAGAATACCTCGGCAAATTCCGACGTCTTGAAGACTTCCGAGTAGATCCCCCCATGGGTGAGGAGGGCAACCACAAGCGACACTCAGTGGTAGCAGGAGGTGGCGGCGGTGAGGGCAGGAAGCGGTGCCCCTCCCAGTCTTCCAGCAGGCCTGCTGCCATGATCAGCCAACCCCCTACACCACCCACCGGCCAGCCTGTCCGGGAAGATGCCAAATGGACAAGCCAGCACTCGAACACACAGACTTTGGGAAAGTGA

Length: 3060

View AllClose

0 Reviews

View AllClose