Cusabio Customized Plasmid
Human LARP1 cDNA Clone BC010144 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL740795HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LARP1
- Gene ID:
- 23367
- Accession #:
- BC010144
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human LARP1 cDNA Clone BC010144 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: LARP1
Gene ID: 23367
Accession Number: BC010144
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTTAGGAGTTAATGTTGCAAAGAGTAGTTTACATCTTCACTTTCTGAAGACACTTGAATTTAGGACCGATGTATCTGTGACAAGCATGCCAGAAGTGGCAGGGGCCATCAGGGCTAACCACTTCACACCTACCATCGTCCCATGGGGATCCAAGACCTGA
Length: 162
Related Products
Human LARP1 cDNA Clone BC033856 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human LARP1 cDNA Clone BC033856 pENTR223.1 or pUC Plasmid | CusabioGene Name: LARP1Gene ID: 23367Accession Number: BC033856Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL740795HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LARP1
- Gene ID:
- 23367
- Accession #:
- BC033856
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LARP1 cDNA Clone BC001460 pUC Plasmid
Cusabio pUC Plasmid
€1,047.00
Human LARP1 cDNA Clone BC001460 pUC Plasmid | CusabioGene Name: LARP1Gene ID: 23367Accession Number: BC001460Vector: pUCSequence:...
- SKU:
- CSB-CL740795HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LARP1
- Gene ID:
- 23367
- Accession #:
- BC001460
- Plasmid:
- pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC