Human EGFL8 cDNA Clone BC052591 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL860784HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGFL8
Gene ID:
80864
Accession #:
BC052591
Plasmid:
pUC
€328.00
Frequently bought together:

Description

Human EGFL8 cDNA Clone BC052591 pUC Plasmid | Cusabio

Gene Name: EGFL8

Gene ID: 80864

Accession Number: BC052591

Vector: pUC

Sequence: ATGGGGTCCAGGGCTGAGCTGTGCACTCTCTTAGGCGGATTCTCCTTCCTCCTGCTACTGATACCAGGCGAGGGGGCCAAGGGTGGATCCCTCAGAGAGAGTCAGGGAGTCTGCTCCAAGCAGACACTGGTGGTCCCGCTCCACTACAACGAGTCCTACAGCCAACCAGTGTACAAGCCCTACCTGACCTTGTGCGCTGGGAGGCGCATCTGCAGCACTTACAGGACCATGTACCGCGTTATGTGGCGGGAGGTGAGGCGGGAGGTTCAGCAGACCCATGCAGTGTGCTGCCAGGGCTGGAAGAAGCGGCACCCGGGGGCGCTCACCTGTGAAGCCATCTGCGCCAAGCCTTGCCTGAACGGAGGCGTCTGCGTTAGGCCTGACCAGTGCGAGTGCGCCCCCGGCTGGGGAGGGAAGCACTGTCATGTGGACGTGGATGAATGTAGGACCAGCATCACCCTCTGCTCGCACCATTGTTTTAATACGGCAGGCAGCTTCACCTGCGGCTGCCCCCATGACCTAGTGCTAGGCGTGGACGGGCGCACCTGCATGGAGGGGTCCCCAGAGCCCCCAACCAGTGCCAGCATACTCAGCGTGGCCGTTCGGGAGGCGGAAAAAGATGAGCGCGCTCTGAAGCAGGAGATTCACGAGCTGCGAGGGCGCCTGGAGCGGCTGGAGCAGTGGGCCGGTCAGGCTGGGGCCTGGGTCAGAGCGGTGCTGCCCGTGCCGCCTGAAGAGCTGCAGCCAGAACAGGTGGCTGAGCTGTGGGGCCGGGGTGACCGGATCGAATCTCTCAGCGACCAGGTGCTGCTGCTGGAGGAGAGGCTAGGTGCCTGCTCCTGTGAGGACAACAGCCTGGGCCTCGGCGTCAATCATCGATAA

Length: 882

View AllClose

0 Reviews

View AllClose