Human EGFL8 cDNA Clone BC035574 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL860784HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EGFL8
Gene ID:
80864
Accession #:
BC035574
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human EGFL8 cDNA Clone BC035574 pENTR223.1 Plasmid | Cusabio

Gene Name: EGFL8

Gene ID: 80864

Accession Number: BC035574

Vector: pENTR223.1

Sequence: ATGGGGTCCAGGGCTGAGCTGTGCACTCTCTTAGGCGGATTCTCCTTCCTCCTGCTACTGATACCAGGCGAGGGGGCCAAGGGTGGATCCCTCAGAGAGAGTCAGGGAGTCTGCTCCAAGCAGACACTGGTGGTCCCGCTCCACTACAACGAGTCCTACAGCCAACCAGTGTACAAGCCCTACCTGACCTTGTGCGCTGGGAGGCGCATCTGCAGCACTTACAGGACCATGTACCGCGTTATGTGGCGGGAGGTGAGGCGGGAGGTTCAGCAGACCCATGCAGTGTGCTGCCAGGGCTGGAAGAAGCGGCACCCGGGGGCGCTCACCTGTGAAGCCATCTGCGCCAAGCCTTGCCTGAACGGAGGCGTCTGCGTTAGGCCTGACCAGTGCGAGTGCGCCCCCGGCTGGGGAGGGAAGCACTGTCATGTGGACGTGGATGAATGTAGGACCAGCATCACCCTCTGCTCGCACCATTGTTTTAATACGGCAGGCAGCTTCACCTGCGGCTGCCCCCATGACCTAGTGCTAGGCGTGGACGGGCGCACCTGCATGGAGGGGTCCCCAGAGCCCCCAACCAGTGCCAGCATACTCAGCGTGGCCGTTCGGGAGGCGGAAAAAGATGAGCGCGCTCTGAAGCAGGAGATTCACGAGCTGCGAGGGCGCCTGGAGCGGCTGGAGCAGTGGGCCGGTCAGGCTGGGGCCTGGGTCAGAGCGGTGCTGCCCGTGCCGCCTGAAGAGCTGCAGCCAGAACAGGTGGCTGAGCTGTGGGGCCGGGGTGACCGGATCGAATCTCTCAGCGACCAGGTGCTGCTGCTGCAGGAGAGGCTAGGTGCCTGCTCCTGTGAGGACAACAGCCTGGGCCTCGGCGTCAATCATCGATAA

Length: 882

View AllClose

0 Reviews

View AllClose