Human EEF1G cDNA Clone BC009865 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007433HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1G
Gene ID:
1937
Accession #:
BC009865
Plasmid:
pUC
€441.00
Frequently bought together:

Description

Human EEF1G cDNA Clone BC009865 pUC Plasmid | Cusabio

Gene Name: EEF1G

Gene ID: 1937

Accession Number: BC009865

Vector: pUC

Sequence: ATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGAGGGCCTTCAAGGCTCTCATCGCTGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCGCACCCCTGAATTTCTCCGCAAATTTCCTGCCGGCAAGGTCCCAGCATTTGAGGGTGATGATGGATTCTGTGTGTTTGAGAGCAACGCCATTGCCTACTATGTGAGCAATGAGGAGCTGCGGGGAAGTACTCCAGAGGCAGCAGCCCAGGTGGTGCAGTGGGTGAGCTTTGCTGATTCCGATATAGTGCCCCCAGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACCACAACAAACAGGCCACTGAGAATGCAAAGGAGGAAGTGAGGCGAATTCTGGGGCTGCTGGATGCTTACTTGAAGACGAGGACTTTTCTGGTGGGCGAACGAGTGACATTGGCTGACATCACAGTTGTCTGCACCCTGTTGTGGCTCTATAAGCAGGTTCTAGAGCCTTCTTTCCGCCAGGCCTTTCCCAATACCAACCGCTGGTTCCTCACCTGCATTAACCAGCCCCAGTTCCGGGCTGTCTTGGGGGAAGTGAAACTGTGTGAGAAGATGGCCCAGTTTGATGCTAAAAAGTTTGCAGAGACCCAACCTAAAAAGGACACACCACGGAAAGAGAAGGGTTCACGGGAAGAGAAGCAGAAGCCCCAGGCTGAGCGGAAGGAGGAGAAAAAGGCGGCTGCCCCTGCTCCTGAGGAGGAGATGGATGAATGTGAGCAGGCGCTGGCTGCTGAGCCCAAGGCCAAGGACCCCTTCGCTCACCTGCCCAAGAGTACCTTTGTGTTGGATGAATTTAAGCGCAAGTACTCCAATGAGGACACACTCTCTGTGGCACTGCCATATTTCTGGGAGCACTTTGATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGAACTCACTCAGACCTTCATGAGCTGCAATCTCATCACTGGAATGTTCCAGCGACTGGACAAGCTGAGGAAGAATGCCTTCGCCAGTGTCATCCTTTTTGGAACCAACAATAGCAGCTCCATTTCTGGAGTCTGGGTCTTCCGAGGCCAGGAGCTTGCCTTTCCGCTGAGTCCAGATTGGCAGGTGGACTACGAGTCATACACATGGCGGAAACTGGATCCTGGCAGCGAGGAGACCCAGACGCTGGTTCGAGAGTACTTTTCCTGGGAGGGGGCCTTCCAGCATGTGGGCAAAGCCTTCAATCAGGGCAAGATCTTCAAGTGA

Length: 1314

View AllClose

0 Reviews

View AllClose