Human EEF1G cDNA Clone BC000384 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007433HU3
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EEF1G
Gene ID:
1937
Accession #:
BC000384
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EEF1G cDNA Clone BC000384 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EEF1G

Gene ID: 1937

Accession Number: BC000384

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGAGGGCCTTCAAGGCTCTCATCGCTGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCGCACCCCTGAATTTCTCCGCAAATTTCCTGCCGGCAAGGTCCCAGCATTTGAGGGTGATGATGGATTCTGTGTGTTTGAGAGCAACGCCATTGCCTACTATGTGAGCAATGAGGAGCTGCGGGGAAGTACTCCAGAGGCAGCAGCCCAGGTGGTGCAGTGGGTGAGCTTTGCTGATTCCGATATAGTGCCCCCAGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACCACAACAAACAGGCCACTGAGAATGCAAAGGAGGAAGTGAGGCGAATTCTGGGGCTGCTGGATGCTTACTTGAAGACGAGGACTTTTCTGGTGGGCGAACGAGTGACATTGGCTGACATCACAGTTGTCTGCACCCTGTTGTGGCTCTATAAGCAGGTTCTAGAGCCTTCTTTCCGCCAGGCCTTTCCCAATACCAACCGCTGGTTCCTCACCTGCATTAACCAGCCCCAGTTCCGGGCTGTCTTGGGCGAAGTGAAACTGTGTGAGAAGATGGCCCAGTTTGATGCTAAAAAGTTTGCAGAGACCCAACCTAAAAAGGACACACCACGGAAAGAGAAGGGTTCACGGGAAGAGAAGCAGAAGCCCCAGGCTGAGCGGAAGGAGGAGAAAAAGGCGGCTGCCCCTGCTCCTGAGGAGGAGATGGATGAATGTGAGCAGGCGCTGGCTGCTGAGCCCAAGGCCAAGGACCCCTTCGCTCACCTGCCCAAGAGTACCTTTGTGTTGGATGAATTTAAGCGCAAGTACTCCAATGAGGACACACTCTCTGTGGCACTGCCATATTTCTGGGAGCACTTTGATAAGGACGGCTGGTCCCTGTGGTACTCAGAGTATCGCTTCCCTGAAGAACTCACTCAGACCTTCATGAGCTGCAATCTCATCACTGGAATGTTCCAGCGACTGGACAAGCTGAGGAAGAATGCCTTCGCCAGTGTCATCCTTTTTGGAACCAACAATAGCAGCTCCATTTCTGGAGTCTGGGTCTTCCGAGGCCAGGAGCTTGCCTTTCCGCTGAGTCCAGATTGGCAGGTGGACTACGAGTCATACACATGGCGGAAACTGGATCCTGGCAGCGAGGAGACCCAGACGCTGGTTCGAGAGTACTTTTCCTGGGAGGGGGCCTTCCAGCATGTGGGCAAAGCCTTCAATCAGGGCAAGATCTTCAAGTGA

Length: 1314

View AllClose

0 Reviews

View AllClose