Human EDIL3 cDNA Clone BC030828 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007399HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDIL3
Gene ID:
10085
Accession #:
BC030828
Plasmid:
pENTR223.1
$256.80
Frequently bought together:

Description

Human EDIL3 cDNA Clone BC030828 pENTR223.1 Plasmid | Cusabio

Gene Name: EDIL3

Gene ID: 10085

Accession Number: BC030828

Vector: pENTR223.1

Sequence: ATGAAGCGCTCGGTAGCCGTCTGGCTCTTGGTCGGGCTCAGCCTCAGTGTCCCCCAGTTCGGCAAAGGTGATATTTGTGATCCCAATCCATGTGAAAATGGAGGTATCTGTTTGCCAGGATTGGCTGATGGTTCCTTTTCCTGTGAGTGTCCAGATGGCTTCACAGACCCCAACTGTTCTAGTGTTGTGGAGGTTGCATCAGATGAAGAAGAACCAACTTCAGCAGGTCCCTGCACTCCTAATCCATGCCATAATGGAGGAACCTGTGAAATAAGTGAAGCATACCGAGGGGATACATTCATAGGCTATGTTTGTAAATGTCCCCGAGGATTTAATGGGATTCACTGTCAGCACAACATAAATGAATGCGAAGTTGAGCCTTGCAAAAATGGTGGAATATGTACAGATCTTGTTGCTAACTATTCCTGTGAGTGCCCAGGCGAATTTATGGGAAGAAATTGTCAATACAAATGCTCAGGCCCACTGGGAATTGAAGGTGGAATTATATCAAACCAGCAAATCACAGCTTCCTCTACTCACCGAGCTCTTTTTGGACTCCAAAAATGGTATCCCTACTATGCACGTCTTAATAAGAAGGGGCTTATAAATGCGTGGACAGCTGCAGAAAATGACAGATGGCCGTGGATTCAGATAAATTTGCAAAGGAAAATGAGAGTTACTGGTGTGATTACCCAAGGAGCCAAGAGGATTGGAAGCCCAGAGTATATAAAATCCTACAAAATTGCCTACAGTAATGATGGAAAGACTTGGGCAATGTACAAAGTGAAAGGCACCAATGAAGACATGGTGTTTCGTGGAAACATTGATAACAACACTCCATATGCTAACTCTTTCACACCCCCCATAAAAGCTCAGTATGTAAGACTCTATCCCCAAGTTTGTCGAAGACATTGCACTTTGCGAATGGAACTTCTTGGCTGTGAACTGTCGGGTTGTTCTGAGCCTCTGGGTATGAAATCAGGACATATACAAGACTATCAGATCACTGCCTCCAGCATCTTCAGAACGCTCAACATGGACATGTTCACTTGGGAACCAAGGAAAGCTCGGCTGGACAAGCAAGGCAAAGTGAATGCCTGGACCTCTGGCCACAATGACCAGTCACAATGGTTACAGGTGGATCTTCTTGTTCCAACCAAAGTGACTGGCATCATTACACAAGGAGCTAAAGATTTTGGTCATGTACAGTTTGTTGGCTCCTACAAACTGGCTTACAGCAATGATGGAGAACACTGGACTGTATACCAGGATGAAAAGCAAAGAAAAGATAAGGTTTTCCAGGGAAATTTTGACAATGACACTCACAGAAAAAATGTCATCGACCCTCCCATCTATGCACGACACATAAGAATCCTTCCTTGGTCCTGGTACGGGAGGATCACATTGCGGTCAGAGCTGCTGGGCTGCACAGAGGAGGAATGA

Length: 1443

View AllClose

0 Reviews

View AllClose