Human EDIL3 cDNA Clone BC053656 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007399HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
EDIL3
Gene ID:
10085
Accession #:
BC053656
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human EDIL3 cDNA Clone BC053656 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: EDIL3

Gene ID: 10085

Accession Number: BC053656

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAGCGCTCGGTAGCCGTCTGGCTCTTGGTCGGGCTCAGCCTCGGTGTCCCCCAGTTCGGCAAAGGTGATATTTGTGATCCCAATCCATGTGAAAATGGAGGTATCTGTTTGCCAGGATTGGCTGATGGTTCCTTTTCCTGTGAGTGTCCAGATGGCTTCACAGACCCCAACTGTTCTAGTGTTGTGGAGGTTGGTCCCTGCACTCCTAATCCATGCCATAATGGAGGAACCTGTGAAATAAGTGAAGCATACCGAGGGGATACATTCATAGGCTATGTTTGTAAATGTCCCCGAGGATTTAATGGGATTCACTGTCAGCACAACATAAATGAATGCGAAGTTGAGCCTTGCAAAAATGGTGGAATATGTACAGATCTTGTTGCTAACTATTCCTGTGAGTGCCCAGGCGAATTTATGGGAAGAAATTGTCAATACAAATGCTCAGGCCCACTGGGAATTGAAGGTGGAATTATATCAAACCAGCAAATCACAGCTTCCTCTACTCACCGAGCTCTTTTTGGACTCCAAAAATGGTATCCCTACTATGCACGTCTTAATAAGAAGGGGCTTATAAATGCGTGGACAGCTGCAGAAAATGACAGATGGCCGTGGATTCAGATAAATTTGCAAAGGAAAATGAGAGTTACTGGTGTGATTACCCAAGGAGCCAAGAGGATTGGAAGCCCAGAGTATATAAAATCCTACAAAATTGCCTACAGTAATGATGGAAAGACTTGGGCAATGTACAAAGTGAAAGGCACCAATGAAGACATGGTGTTTCGTGGAAACATTGATAACAACACTCCATATGCTAACTCTTTCACACCCCCCATAAAAGCTCAGTATGTAAGACTCTATCCCCAAGTTTGTCGAAGACATTGCACTTTGCGAATGGAACTTCTTGGCTGTGAACTGTCAGGTTGTTCTGAGCCTCTGGGTATGAAATCAGGACATATACAAGACTATCAGATCACTGCCTCCAGCATCTTCAGAACGCTCAACATGGACATGTTCACTTGGGAACCAAGGAAAGCTCGGCTGGACAAGCAAGGCAAAGTGAATGCCTGGACCTCTGGCCACAATGACCAGTCACAATGGTTACAGGTGGATCTTCTTGTTCCAACCAAAGTGACTGGCATCATTACACAAGGAGCTAAAGATTTTGGTCATGTACAGTTTGTTGGCTCCTACAAACTGGCTTACAGCAATGATGGAGAACACTGGACTGTATACCAGGATGAAAAGCAAAGAAAAGATAAGGTTTTCCAGGGAAATTTTGACAATGACACTCACAGAAAAAATGTCATCGACCCTCCCATCTATGCACGACACATAAGAATCCTTCCTTGGTCCTGGTACGGGAGGATCACATTGCGGTCAGAGCTGCTGGGCTGCACAGAGGAGGAATGA

Length: 1413

View AllClose

0 Reviews

View AllClose