Human E2F8 cDNA Clone BC126400 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007349HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E2F8
Gene ID:
79733
Accession #:
BC126400
Plasmid:
pUC
€777.00
Frequently bought together:

Description

Human E2F8 cDNA Clone BC126400 pUC Plasmid | Cusabio

Gene Name: E2F8

Gene ID: 79733

Accession Number: BC126400

Vector: pUC

Sequence: ATGGAGAACGAAAAGGAAAATCTCTTTTGTGAGCCACATAAAAGGGGACTAATGAAAACACCTCTGAAAGAATCCACCACAGCAAATATCGTGTTGGCAGAGATCCAGCCTGACTTTGGCCCTTTAACCACACCTACCAAGCCCAAGGAAGGCTCTCAGGGAGAGCCGTGGACACCGACAGCCAACCTGAAAATGCTCATCAGTGCTGTGAGCCCTGAGATCCGCAACAGAGATCAGAAAAGGGGTTTGTTTGACAACAGAAGTGGATTACCTGAGGCCAAAGACTGTATACACGAACACTTATCTGGAGATGAATTTGAGAAATCCCAACCAAGTCGAAAAGAGAAAAGTTTAGGATTATTGTGTCATAAGTTCTTAGCACGATATCCTAATTATCCCAACCCTGCTGTGAATAATGACATCTGCCTTGACGAAGTGGCAGAGGAACTTAATGTTGAACGTCGACGCATTTACGATATCGTGAACGTCCTAGAGAGTTTACATATGGTGAGCCGCCTCGCCAAAAACAGGTACACTTGGCACGGGCGACACAATCTCAACAAAACCCTTGGCACCTTGAAGAGCATCGGGGAGGAGAATAAGTACGCCGAGCAGATTATGATGATCAAAAAGAAAGAATATGAGCAAGAGTTTGACTTTATTAAGAGTTACAGTATAGAGGATCATATCATCAAATCAAACACTGGCCCAAATGGACACCCAGACATGTGTTTTGTGGAACTCCCTGGAGTGGAATTTCGGGCAGCTTCTGTAAACAGCCGCAAAGACAAGTCTTTAAGGGTAATGAGCCAGAAATTTGTGATGCTGTTTTTGGTGTCAACGCCTCAGATAGTAAGCCTAGAAGTTGCTGCCAAGATTTTAATTGGGGAGGACCATGTGGAAGATTTGGATAAAAGCAAGTTTAAAACAAAAATTAGGAGGTTGTATGATATAGCTAATGTTCTGAGTAGCCTGGATCTTATCAAGAAAGTTCATGTTACAGAGGAAAGAGGCCGAAAACCAGCTTTCAAATGGACCGGCCCAGAAATCAGTCCAAATACCAGTGGCTCCAGCCCAGTCATTCATTTTACTCCCTCTGATTTGGAGGTGAGACGGTCTTCAAAAGAGAACTGTGCCAAAAACCTCTTTTCCACACGTGGGAAACCAAACTTTACTCGACACCCATCTCTTATCAAATTGGTAAAGAGTATAGAAAGTGATCGGAGAAAGATAAATTCTGCGCCCAGTAGCCCTATCAAGACCAACAAAGCTGAGAGTTCTCAGAATTCTGCACCCTTCCCAAGTAAAATGGCTCAGCTCGCAGCTATTTGTAAAATGCAGTTAGAAGAGCAATCAAGTGAATCCAGACAGAAAGTGAAAGTACAGCTGGCAAGATCTGGACCCTGCAAACCAGTAGCCCCTCTGGACCCCCCAGTGAATGCTGAGATGGAGCTGACAGCACCGTCCCTCATCCAGCCCCTGGGAATGGTTCCCCTGATCCCCAGCCCCTTGTCATCAGCAGTGCCCCTGATCCTACCTCAGGCCCCTTCAGGCCCATCCTATGCCATCTACCTGCAGCCCACTCAAGCCCACCAAAGTGTGACCCCACCCCAAGGCCTGAGCCCAACGGTGTGCACCACCCACTCTTCTAAAGCTACTGGCTCAAAAGACTCCACAGATGCCACCACTGAGAAGGCAGCCAATGATACCTCAAAGGCCAGTGCCTCTACCAGGCCTGGAAGCTTGCTGCCAGCACCAGAGAGGCAAGGGGCAAAGAGCCGAACCAGGGAGCCAGCTGGAGAAAGAGGCTCAAAGAGGGCAAGCATGCTCGAGGACAGTGGTTCCAAAAAGAAATTTAAAGAGGACCTAAAAGGACTTGAAAATGTCTCCGCAACCTTGTTCCCATCAGGATACCTAATCCCTCTCACGCAGTGCTCATCCCTGGGGGCAGAGTCCATTTTGTCTGGTAAAGAAAACTCAAGTGCTCTTTCCCCAAACCACAGGATTTACAGCTCCCCAATTGCAGGTGTTATTCCAGTGACATCATCTGAACTCACTGCTGTTAATTTTCCCTCTTTTCATGTAACACCGTTGAAGCTAATGGTCTCACCAACTTCCGTGGCAGCCGTACCTGTCGGGAACAGCCCGGCTCTCGCTTCAAGCCACCCTGTTCCCATCCAGAACCCAAGCTCAGCCATTGTAAACTTCACCCTGCAGCACCTGGGACTCATCTCACCCAATGTGCAGTTGTCTGCCAGCCCTGGGTCTGGAATCGTTCCTGTGTCTCCAAGAATAGAGTCTGTTAATGTCGCACCAGAAAATGCAGGCACTCAGCAAGGAAGGGCCACCAACTATGACTCACCAGTCCCAGGCCAGAGCCAGCCAAATGGACAATCAGTTGCTGTGACAGGGGCACAACAGCCTGTTCCTGTGACACCCAAAGGGTCACAATTAGTGGCCGAAAGTTTCTTCCGTACCCCAGGTGGACCCACCAAGCCAACCAGCTCATCCTGCATGGATTTTGAGGGTGCTAATAAAACCTCCTTAGGAACTCTCTTTGTCCCACAGCGAAAACTGGAAGTCTCAACAGAGGATGTCCATTAA

Length: 2604

View AllClose

0 Reviews

View AllClose