Human E2F8 cDNA Clone BC028244 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL007349HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
E2F8
Gene ID:
79733
Accession #:
BC028244
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human E2F8 cDNA Clone BC028244 pENTR223.1 Plasmid | Cusabio

Gene Name: E2F8

Gene ID: 79733

Accession Number: BC028244

Vector: pENTR223.1

Sequence: ATGGCTCAGCTTGCAGCTATTTGTAAAATGCAGTTAGAAGAGCAATCAAGTGAATCCAGACAGAAAGTGAAAGTACAGCTGGCAAGATCTGGACCCTGCAAACCAGTAGCCCCTCTGGACCCCCCAGTGAATGCTGAGATGGAGCTGACAGCACCGTCCCTCATCCAGCCCCTGGGAATGGTTCCCCTGATCCCCAGCCCCTTGTCATCAGCAGTGCCCCTGATCCTACCTCAGGCCCCTTCAGGCCCATCCTATGCCATCTACCTGCAGCCCACTCAAGCCCACCAAAGTGTGACGCCACCCCAAGGCCTGAGCCCAACGGTGTGCACCACCCACTCTTCTAAAGCTACTGGCTCAAAAGACTCCACAGATGCCACCACTGAGAAGGCAGCCAATGATACCTCAAAGGCCAGTGCCTCTACCAGGCCTGGAAGCTTGCTGCCAGCACCAGAGAGGCAAGGGGCAAAGAGCCGAACCAGGGAGCCAGCTGGAGAAAGAGGCTCAAAGAGGGCAAGCATGCTCGAGGACAGTGGTTCCAAAAAGAAATTTAAAGAGGACCTAAAAGGACTTGAAAATGTCTCCGCAACCTTGTTCCCATCAGGATACCTAATCCCTCTCACGCAGTGCTCATCCCTGGGGGCAGAGTCCATTTTGTCTGGTAAAGAAAACTCAAGTGCTCTTTCCCCAAACCACAGGATTTACAGCTCCCCAATTGCAGGTGTTATTCCAGTGACATCATCTGAACTCACTGCTGTTAATTTTCCCTCTTTTCATGTAACACCGTTGAAGCTAATGGTCTCACCAACTTCCGTGGCAGCCGTACCTGTCGGGAACAGCCCGGCTCTCGCTTCAAGCCACCCTGTTCCCATCCAGAACCCAAGCTCAGCCATTGTAAACTTCACCCTGCAGCACCTGGGACTCATCTCACCCAATGTGCAGTTGTCTGCCAGCCCTGGGTCTGGAATCGTTCCTGTGTCTCCAAGAATAGAGTCTGTTAATGTCGCACCAGAAAATGCAGGCACTCAGCAAGGAAGGGCCACCAACTATGACTCACCAGTCCCAGGCCAGAGCCAGCCAAATGGACAATCAGTTGCTGTGACAGGGGCACAACAGCCTGTTCCTGTGACACCCAAAGGGTCACAATTAGTGGCCGAAAGTTTCTTCCGTACCCCAGGTGGACCCACCAAGCCAACCAGCTCATCCTGCATGGATTTTGAGGGTGCTAATAAAACCTCCTTAGGAACTCTCTTTGTCCCACAGCGAAAACTGGAAGTCTCAACAGAGGATGTCCATTAA

Length: 1296

View AllClose

0 Reviews

View AllClose