Cusabio pUC Plasmid

Human ZNF503 cDNA Clone BC011625 pUC Plasmid

(No reviews yet) Write a Review

SKU:: CSB-CL026796HU3
UPC:
MPN:
Availability:: Inquiry
Size:: 10 μg plasmid + 200μl Glycerol
Gene:: ZNF503
Gene ID:: 84858
Accession #:: BC011625
Plasmid:: pUC

€604.00

Current Stock:

Quantity:

Frequently bought together:

Description
0 Reviews

Description

Human ZNF503 cDNA Clone BC011625 pUC Plasmid | Cusabio

Gene Name: ZNF503

Gene ID: 84858

Accession Number: BC011625

Vector: pUC

Sequence: ATGAGCACAGCGCCCTCGCTTTCTGCCCTAAGAAGCAGTAAGCACAGCGGCGGCGGCGGCGGCGGAGGCGGAGGCGGCGGTGCAGACCCTGCCTGGACCAGCGCGCTCTCTGGAAATAGCTCCGGCCCCGGCCCAGGCTCGTCCCCGGCCGGCAGCACCAAGCCTTTTGTGCACGCCGTGCCCCCCTCTGACCCCCTGCGCCAGGCCAACCGCCTGCCAATCAAGGTGCTGAAGATGCTGACGGCACGAACTGGCCACATTTTGCACCCCGAGTACCTGCAGCCCCTGCCTTCCACGCCGGTCAGCCCCATCGAGCTCGATGCCAAGAAGAGCCCGCTGGCGCTGTTGGCGCAAACATGTTCGCAGATCGGGAAGCCCGACCCCTCGCCCTCCTCCAAACTCTCCTCGGTTGCCTCCAACGGGGGCGGCGCGGGCGGTGCCGGCGGCGGTGCTGCGGGCGACAAGGACACCAAATCGGGCCCCCTGAAGCTGAGCGACATCGGCGTGGAGGACAAGTCGAGTTTCAAGCCGTACTCCAAACCCGGCTCGGATAAGAAGGAGCCGGGAGGCGGCGGTGGAGGCGGTGGCGGTGGCGGGGGCGGCGGCGGGGGTGTTTCGTCGGAGAAGTCGGGATTCCGGGTACCGAGCGCCACCTGCCAGCCATTCACGCCCAGGACAGGCAGCCCGAGCTCCAGCGCCTCGGCCTGCTCGCCGGGAGGTATGCTGTCCTCGGCCGGGGGTGCCCCGGAGGGCAAGGACGACAAGAAAGACACCGACGTGGGCGGCGGTGGCAAGGGCACCGGGGGCGCCTCGGCCGAAGGGGGACCCACGGGGCTGGCACACGGCCGGATTAGCTGCGGCGGCGGGATTAATGTGGATGTGAACCAGCATCCGGATGGGGGCCCGGGAGGCAAGGCTCTGGGCTCGGACTGCGGCGGTTCATCGGGCTCCAGCTCCGGCTCCGGCCCCAGCGCGCCCACCTCCTCCTCAGTGTTGGGCTCTGGGCTGGTGGCTCCCGTGTCACCCTACAAGCCGGGCCAGACAGTGTTCCCTCTGCCTCCCGCGGGTATGACCTACCCAGGCAGCCTGGCCGGGGCCTACGCCGGCTACCCGCCCCAGTTCCTGCCACACGGCGTGGCACTTGACCCCACCAAGCCGGGCAGCCTGGTGGGGGCGCAGCTGGCGGCGGCCGCGGCCGGGTCTCTGGGCTGCAGTAAGCCGGCCGGCTCCAGTCCTTTGGCCGGAGCGTCTCCGCCGTCCGTGATGACAGCCAGTTTGTGCCGGGACCCTTACTGCCTCAGCTACCACTGCGCTAGCCACCTGGCAGGGGCGGCGGCCGCCAGCGCTTCTTGCGCACATGATCCGGCTGCTGCGGCTGCGGCGCTGAAGTCCGGATACCCGCTGGTGTACCCCACGCACCCGCTGCACGGTGTGCACTCCTCGCTAACGGCCGCCGCGGCTGCTGGCGCCACACCGCCCTCCCTGGCCGGCCACCCCCTCTACCCCTACGGCTTTATGCTCCCTAACGACCCACTCCCCCACATCTGCAACTGGGTGTCGGCCAACGGGCCGTGCGACAAGCGCTTCGCCACGTCCGAAGAGCTGCTGAGCCACTTGCGGACCCATACGGCATTTCCCGGGACAGACAAACTGCTGTCGGGCTACCCCAGCTCGTCGTCTCTGGCCAGCGCTGCCGCGGCCGCCATGGCTTGCCACATGCACATCCCCACCTCGGGCGCACCGGGCAGCCCTGGGACGCTGGCGCTGCGCAGCCCCCACCACGCGCTGGGACTCAGCAGCCGCTACCACCCCTACTCCAAGAGCCCGCTTCCCACGCCTGGCGCCCCCGTGCCGGTGCCCGCCGCCACCGGACCGTACTACTCCCCCTACGCCCTCTACGGACAGAGACTGACCACCGCCTCGGCGCTGGGGTATCAGTGA

Length: 1941

View AllClose

0 Reviews

View AllClose

Related Products
Customers Also Viewed

Related Products

Human ZNF266 cDNA Clone BC126255 pUC Plasmid

Cusabio pUC Plasmid

€529.00

Human ZNF266 cDNA Clone BC126255 pUC Plasmid | CusabioGene Name: ZNF266Gene ID: 10781Accession Number: BC126255Vector: pUCSequence:...

Human ZNF471 cDNA Clone BC125221 pUC Plasmid

Cusabio pUC Plasmid

€588.00

Human ZNF471 cDNA Clone BC125221 pUC Plasmid | CusabioGene Name: ZNF471Gene ID: 57573Accession Number: BC125221Vector: pUCSequence:...

Human ZNF500 cDNA Clone BC121013 pUC Plasmid

Cusabio pUC Plasmid

€475.00

Human ZNF500 cDNA Clone BC121013 pUC Plasmid | CusabioGene Name: ZNF500Gene ID: 26048Accession Number: BC121013Vector: pUCSequence:...

Human ZNF503 cDNA Clone BC007494 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF503 cDNA Clone BC007494 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF503Gene ID: 84858Accession Number: BC007494Vector: Vector will be determined during the manufacturing process, either...

Human ZNF503 cDNA Clone BC013011 pUC Plasmid

Cusabio pUC Plasmid

€575.00

Human ZNF503 cDNA Clone BC013011 pUC Plasmid | CusabioGene Name: ZNF503Gene ID: 84858Accession Number: BC013011Vector: pUCSequence:...

Customers Also Viewed

Human ZNF273 cDNA Clone BC063818 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€347.00

Human ZNF273 cDNA Clone BC063818 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF273Gene ID: 10793Accession Number: BC063818Vector: Vector will be determined during the manufacturing process, either...

Human ZNF695 cDNA Clone BC041082 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF695 cDNA Clone BC041082 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF695Gene ID: 57116Accession Number: BC041082Vector: Vector will be determined during the manufacturing process, either...

Human ZNRD1 cDNA Clone BC051741 pUC Plasmid

Cusabio pUC Plasmid

€170.00

Human ZNRD1 cDNA Clone BC051741 pUC Plasmid | CusabioGene Name: ZNRD1Gene ID: 30834Accession Number: BC051741Vector: pUCSequence:...

Human ZNF3 cDNA Clone BC008031 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF3 cDNA Clone BC008031 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF3Gene ID: 7551Accession Number: BC008031Vector: Vector will be determined during the manufacturing process, either...

Human ZNF254 cDNA Clone BC139749 pUC Plasmid

Cusabio pUC Plasmid

€614.00

Human ZNF254 cDNA Clone BC139749 pUC Plasmid | CusabioGene Name: ZNF254Gene ID: 9534Accession Number: BC139749Vector: pUCSequence:...

Human ZNF343 cDNA Clone BC065009 pUC Plasmid

Cusabio pUC Plasmid

€568.00

Human ZNF343 cDNA Clone BC065009 pUC Plasmid | CusabioGene Name: ZNF343Gene ID: 79175Accession Number: BC065009Vector: pUCSequence:...

CX3CL1 Antibody | CSB-PA092112

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CX3CL1 Antibody | CSB-PA092112 | CusabioCX3CL1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product Type:...

GPC3 Antibody | CSB-RA009705A0HU

Cusabio Recombinant Antibodies

€373.00 - €555.00

GPC3 Antibody | CSB-RA009705A0HU | CusabioGPC3 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Antibody...

Defensin-like protein 1 Antibody | CSB-PA316614LA01DAE

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Defensin-like protein 1 Antibody | CSB-PA316614LA01DAE | CusabioDefensin-like protein 1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

Recombinant Severe acute respiratory syndrome coronavirus 2 Non-structural protein 3 (nsp3), partial | CSB-EP3398GND

Cusabio Covid-19 Recombinants

€112.00 - €1,277.00

Recombinant Severe acute respiratory syndrome coronavirus 2 Non-structural protein 3 (nsp3), partial | CSB-EP3398GND | CusabioTarget Name: NSP3Uniprot No: P0DTD1/YP_009725299.1Species: Severe acute...

Tri-methyl-Histone H4 (K20) Antibody | CSB-RA010429A20me3HU

Cusabio Recombinant Antibodies

€373.00 - €555.00

Tri-methyl-Histone H4 (K20) Antibody | CSB-RA010429A20me3HU | CusabioTri-methyl-Histone H4 (K20) Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible...

CD4-like protein Antibody | CSB-PA29711A0Rb

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CD4-like protein Antibody | CSB-PA29711A0Rb | CusabioCD4-like protein Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to...

CCL17 Antibody, Biotin conjugated | CSB-PA856406LD01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CCL17 Antibody, Biotin conjugated | CSB-PA856406LD01HU | CusabioCCL17 Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

CCL17 Antibody, FITC conjugated | CSB-PA856406LC01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CCL17 Antibody, FITC conjugated | CSB-PA856406LC01HU | CusabioCCL17 Antibody, FITC conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

Recombinant Human C-C motif chemokine 3 (CCL3) (Active) | CSB-AP003531HU

Cusabio Active Proteins

€246.00 - €539.00

Recombinant Human C-C motif chemokine 3 (CCL3) (Active) | CSB-AP003531HU | CusabioProtein Description: Full Length of Mature ProteinAlternative Name (s) : C-C Motif Chemokine 3; G0/G1 Switch...

Recombinant Rat Fractalkine protein (Cx3cl1) (Active) | CSB-AP001511RA

Cusabio Active Proteins

€192.00 - €2,141.00

Recombinant Rat Fractalkine protein (Cx3cl1) (Active) | CSB-AP001511RA | CusabioProtein Description: PartialAlternative Name (s) : C-X3-C motif chemokine 1, Neurotactin, Small-inducible cytokine D1,...

Recombinant Human Lysyl oxidase homolog 3 (LOXL3), partial | CSB-EP013042HU1

Cusabio Human Recombinants

€298.00 - €1,702.00

Recombinant Human Lysyl oxidase homolog 3 (LOXL3), partial | CSB-EP013042HU1 | CusabioAlternative Name(s): Lysyl oxidase-like protein 3Gene Names: LOXL3Research Areas: Signal TransductionOrganism:...

Pollen allergen Phl p 5a Antibody, Biotin conjugated | CSB-PA669216HD01EUQ

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Pollen allergen Phl p 5a Antibody, Biotin conjugated | CSB-PA669216HD01EUQ | CusabioPollen allergen Phl p 5a Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery...

Pollen allergen Phl p 5a Antibody, FITC conjugated | CSB-PA669216HC01EUQ

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Pollen allergen Phl p 5a Antibody, FITC conjugated | CSB-PA669216HC01EUQ | CusabioPollen allergen Phl p 5a Antibody, FITC conjugated is Available at Gentaur Genprice with the fastest delivery.Online...

LOXL2 Antibody, Biotin conjugated | CSB-PA897283LD01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

LOXL2 Antibody, Biotin conjugated | CSB-PA897283LD01HU | CusabioLOXL2 Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

LOXL2 Antibody, HRP conjugated | CSB-PA897283LB01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

LOXL2 Antibody, HRP conjugated | CSB-PA897283LB01HU | CusabioLOXL2 Antibody, HRP conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

Allergen Ara h 1, clone P17 Antibody, Biotin conjugated | CSB-PA331779LD01ANE

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Allergen Ara h 1, clone P17 Antibody, Biotin conjugated | CSB-PA331779LD01ANE | CusabioAllergen Ara h 1, clone P17 Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest...

Allergen Ara h 1, clone P17 Antibody, FITC conjugated | CSB-PA331779LC01ANE

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Allergen Ara h 1, clone P17 Antibody, FITC conjugated | CSB-PA331779LC01ANE | CusabioAllergen Ara h 1, clone P17 Antibody, FITC conjugated is Available at Gentaur Genprice with the fastest delivery...

Allergen Ara h 1, clone P17 Antibody, HRP conjugated | CSB-PA331779LB01ANE

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Allergen Ara h 1, clone P17 Antibody, HRP conjugated | CSB-PA331779LB01ANE | CusabioAllergen Ara h 1, clone P17 Antibody, HRP conjugated is Available at Gentaur Genprice with the fastest delivery...

Allergen Ara h 1, clone P17 Antibody | CSB-PA331779LA01ANE

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Allergen Ara h 1, clone P17 Antibody | CSB-PA331779LA01ANE | CusabioAllergen Ara h 1, clone P17 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or...

NGFRAP1 Antibody | CSB-PA923759

Cusabio Polyclonal Antibodies

€315.80 - €488.70

NGFRAP1 Antibody | CSB-PA923759 | CusabioNGFRAP1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product...

NGFRAP1 Antibody | CSB-PA015781GA01HU

Cusabio Polyclonal Antibodies

€470.50 - €990.50

NGFRAP1 Antibody | CSB-PA015781GA01HU | CusabioNGFRAP1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com...

CETN3 Antibody | CSB-PA005266GA01HU

Cusabio Polyclonal Antibodies

€470.50 - €990.50

CETN3 Antibody | CSB-PA005266GA01HU | CusabioCETN3 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product...

Monkey 25-hydroxy vitamin D3 (25 HVD3) ELISA kit | CSB-EQ027277MK

Cusabio Elisa

€413.70 - €4,084.55

Monkey 25-hydroxy vitamin D3 (25 HVD3) ELISA kit | CSB-EQ027277MK | CusabioMonkey 25-hydroxy vitamin D3 (25 HVD3) ELISA kit is Available at Gentaur Genprice with the fastest delivery.Online Order...

Recombinant Conus marmoreus Conotoxin mr3e | CSB-EP691651DWD

Cusabio Virus & Bacteria Recombinants

€352.00 - €1,702.00

Recombinant Conus marmoreus Conotoxin mr3e | CSB-EP691651DWD | CusabioAlternative Name(s): Mr3.4 Mr3.7Gene Names: N/AResearch Areas: othersOrganism: Conus marmoreus (Marble cone)AA Sequence:...

Recombinant Human Centrin-3 (CETN3) | CSB-EP005266HU

Cusabio Human Recombinants

€245.00 - €1,277.00

Recombinant Human Centrin-3 (CETN3) | CSB-EP005266HU | CusabioAlternative Name(s): CDC31 homolog; CEN 3; CEN3; Centrin EF hand protein 3; Centrin-3; Centrin3; CETN 3; Cetn3; CETN3_HUMAN; EF hand...

HIST1H1E (Ab-25) Antibody | CSB-PA010380PA25nme1HU

Cusabio Polyclonal Antibodies

€327.50 - €514.70

HIST1H1E (Ab-25) Antibody | CSB-PA010380PA25nme1HU | CusabioHIST1H1E (Ab-25) Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to...

Pollen allergen Phl p 5a Antibody, HRP conjugated | CSB-PA669216HB01EUQ

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Pollen allergen Phl p 5a Antibody, HRP conjugated | CSB-PA669216HB01EUQ | CusabioPollen allergen Phl p 5a Antibody, HRP conjugated is Available at Gentaur Genprice with the fastest delivery.Online...

DSG3 Antibody, Biotin conjugated | CSB-PA007205YD01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

DSG3 Antibody, Biotin conjugated | CSB-PA007205YD01HU | CusabioDSG3 Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

DSG3 Antibody, HRP conjugated | CSB-PA007205YB01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

DSG3 Antibody, HRP conjugated | CSB-PA007205YB01HU | CusabioDSG3 Antibody, HRP conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation...

DSG3 Antibody | CSB-PA007205YA01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

DSG3 Antibody | CSB-PA007205YA01HU | CusabioDSG3 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product...

LOXL2 Antibody, FITC conjugated | CSB-PA897283LC01HU

Cusabio Polyclonal Antibodies

€315.80 - €488.70

LOXL2 Antibody, FITC conjugated | CSB-PA897283LC01HU | CusabioLOXL2 Antibody, FITC conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

mrkA Antibody, Biotin conjugated | CSB-PA318939LD01KBG

Cusabio Polyclonal Antibodies

€315.80 - €488.70

mrkA Antibody, Biotin conjugated | CSB-PA318939LD01KBG | CusabiomrkA Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

fim3 Antibody, Biotin conjugated | CSB-PA322971LD01BUA

Cusabio Polyclonal Antibodies

€315.80 - €488.70

fim3 Antibody, Biotin conjugated | CSB-PA322971LD01BUA | Cusabiofim3 Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

fim3 Antibody, FITC conjugated | CSB-PA322971LC01BUA

Cusabio Polyclonal Antibodies

€315.80 - €488.70

fim3 Antibody, FITC conjugated | CSB-PA322971LC01BUA | Cusabiofim3 Antibody, FITC conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

Genome polyprotein Antibody | CSB-PA18549A0Rb

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Genome polyprotein Antibody | CSB-PA18549A0Rb | CusabioGenome polyprotein Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to...

Recombinant Human Delta-like protein 3 (DLL3), partial (Active) | CSB-MP882142HU

Cusabio Active Proteins

€209.00 - €339.00

Recombinant Human Delta-like protein 3 (DLL3) ,partial (Active) | CSB-MP882142HU | CusabioProtein Description: PartialAlternative Name (s) : Gene Names: DLL3Research Areas: Cell BiologySpecies: Homo...

Recombinant Human Glypican-3 (GPC3), partial (Active) | CSB-AP005371HU

Cusabio Active Proteins

€213.00 - €414.00

Recombinant Human Glypican-3 (GPC3) ,partial (Active) | CSB-AP005371HU | CusabioProtein Description: PartialAlternative Name (s) : Glypican-3; GTR2-2; Intestinal protein OCI-5; MXR7; GPC3; OCI5Gene...

Recombinant Arachis hypogaea Arachin Ahy-3, partial | CSB-YP737391ANE

Cusabio Arachis hypogaea Recombinants

€383.00 - €1,345.00

Recombinant Arachis hypogaea Arachin Ahy-3, partial | CSB-YP737391ANE | CusabioAlternative Name(s): Arachin Ahy-3 [Cleaved into: Arachin Ahy-3 chain alpha; Arachin Ahy-3 chain beta]Gene Names:...

Recombinant Human Protein BEX3 (NGFRAP1) | CSB-YP015781HU

Cusabio Human Recombinants

€262.00 - €943.00

Recombinant Human Protein BEX3 (NGFRAP1) | CSB-YP015781HU | CusabioAlternative Name(s): Brain-expressed X-linked protein 3Nerve growth factor receptor-associated protein 1Ovarian granulosa cell 13...

Recombinant Rat Glypican-3 (Gpc3), partial | CSB-YP009705RA

Cusabio Rattus norvegicus Recombinants

€298.00 - €1,708.00

Recombinant Rat Glypican-3 (Gpc3), partial | CSB-YP009705RA | CusabioAlternative Name(s): Intestinal protein OCI-5Gene Names: Gpc3Research Areas: OthersOrganism: Rattus norvegicus (Rat)AA Sequence:...

Recombinant Human Butyrophilin subfamily 3 member A3 (BTN3A3), partial | CSB-YP002875HU

Cusabio Human Recombinants

€262.00 - €1,406.00

Recombinant Human Butyrophilin subfamily 3 member A3 (BTN3A3), partial | CSB-YP002875HU | CusabioAlternative Name(s): BT3A3_HUMAN; BTF3; BTN3A3; Butyrophilin subfamily 3 member A3Gene Names:...

Recombinant Human Calmodulin-like protein 3 (CALML3) | CSB-EP004453HU

Cusabio Human Recombinants

€245.00 - €1,277.00

Recombinant Human Calmodulin-like protein 3 (CALML3) | CSB-EP004453HU | CusabioAlternative Name(s): CaM-like proteinGene Names: CALML3Research Areas: Tags & Cell MarkersOrganism: Homo sapiens...

Recombinant Human 5-hydroxytryptamine receptor 3D (HTR3D), partial | CSB-CF747864HU

Cusabio Human Recombinants

€644.00 - €902.00

Recombinant Human 5-hydroxytryptamine receptor 3D (HTR3D), partial | CSB-CF747864HU | CusabioAlternative Name(s): Serotonin receptor 3DGene Names: HTR3DResearch Areas: OthersOrganism: Homo sapiens...

Pollen allergen Phl p 5a Antibody | CSB-PA669216HA01EUQ

Cusabio Polyclonal Antibodies

€315.80 - €488.70

Pollen allergen Phl p 5a Antibody | CSB-PA669216HA01EUQ | CusabioPollen allergen Phl p 5a Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...