null

Human ZNF41 cDNA Clone BC015023 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL026729HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZNF41
Gene ID:
7592
Accession #:
BC015023
Plasmid:
pUC
€708.00
Frequently bought together:

Description

Human ZNF41 cDNA Clone BC015023 pUC Plasmid | Cusabio

Gene Name: ZNF41

Gene ID: 7592

Accession Number: BC015023

Vector: pUC

Sequence: ATGGCAGCTAATGGGGACTCTCCCCCATGGTCCCCGGCCCTGGCTGCAGAGGGACGTGGCAGCTCATGTGAGGCTTCAGTGTCATTTGAGGACGTGACTGTGGACTTCAGCAAGGAGGAGTGGCAGCACTTGGACCCTGCCCAGAGACGCCTGTACTGGGATGTGACACTAGAGAACTACAGCCACCTGCTCTCAGTGGGGTACCAAATTCCCAAGTCAGAGGCTGCCTTCAAGTTGGAGCAAGGAGAGGGGCCATGGATGCTGGAGGGGGAAGCCCCACATCAGAGCTGTTCAGGTGAGGCTATTGGGAAAATGCAGCAACAGGGAATTCCTGGAGGAATTTTCTTCCACTGTGAGAGATTTGATCAACCCATAGGAGAAGATTCATTATGTTCTATTTTAGAAGAACTGTGGCAAGATAATGACCAGCTAGAGCAACGTCAGGAAAACCAGAATAACCTTTTAAGTCATGTGAAAGTATTGATTAAGGAGAGGGGCTATGAACATAAAAACATTGAAAAAATAATTCATGTGACTACCAAGCTTGTTCCTTCAATTAAAAGACTCCATAACTGTGACACAATTTTGAAGCATACTTTAAACTCACATAATCATAATAGAAACAGTGCAACAAAGAACCTTGGCAAGATTTTTGGAAATGGTAACAATTTCCCCCATAGCCCTTCCTCTACTAAGAATGAGAATGCTAAAACAGGAGCAAATTCCTGTGAACATGACCACTATGAAAAACATCTCAGCCACAAACAAGCTCCCACCCACCATCAGAAAATTCATCCTGAGGAGAAGCTTTATGTGTGTACTGAATGTGTAATGGGCTTCACTCAGAAGTCACATCTGTTTGAGCATCAGAGAATTCATGCTGGAGAAAAGTCCCGTGAATGTGACAAAAGCAACAAAGTCTTCCCCCAGAAACCCCAGGTTGATGTACATCCAAGTGTTTATACAGGAGAAAAACCCTATCTGTGTACTCAATGTGGGAAAGTCTTTACCCTCAAATCAAACCTCATTACACATCAAAAAATTCATACCGGGCAGAAACCCTACAAATGCAGTGAATGTGGAAAAGCCTTTTTCCAGAGATCAGACCTCTTTAGACATCTGAGAATTCATACAGGAGAAAAACCTTATGAATGCAGTGAATGTGGAAAAGGCTTCTCCCAGAACTCAGACCTCAGTATACATCAGAAAACTCATACCGGAGAGAAACACTATGAATGCAATGAATGTGGGAAGGCTTTCACAAGAAAATCAGCACTCAGGATGCATCAGAGAATCCACACGGGAGAGAAACCTTATGTATGCGCTGACTGTGGGAAGGCCTTCATCCAGAAATCACATTTCAACACACATCAGAGAATTCATACTGGAGAAAAGCCGTATGAATGCAGTGACTGTGGGAAATCCTTCACTAAGAAGTCACAACTCCATGTGCATCAAAGAATTCACACCGGAGAGAAACCCTATATATGTACAGAATGTGGAAAGGTCTTCACTCACAGGACAAACCTCACCACACATCAGAAAACTCATACTGGGGAAAAACCCTATATGTGTGCTGAATGTGGAAAGGCTTTTACTGACCAGTCAAATCTCATTAAACACCAGAAAACTCACACTGGAGAGAAACCCTATAAGTGCAATGGCTGTGGAAAAGCCTTCATATGGAAGTCGCGCCTCAAAATACATCAGAAATCTCATATTGGAGAGAGACACTATGAATGCAAGGACTGCGGGAAAGCCTTCATCCAGAAATCAACACTAAGCGTGCATCAGAGAATCCATACAGGAGAGAAACCGTACGTTTGTCCTGAATGCGGGAAGGCCTTTATCCAGAAATCGCACTTCATTGCGCATCATAGAATCCATACTGGAGAGAAGCCTTATGAATGCAGCGACTGTGGGAAATGCTTCACTAAGAAGTCACAACTCCGTGTGCATCAGAAAATCCACACAGGTGAGAAGCCCAATATATGTGCTGAATGTGGAAAGGCCTTCACTGACCGATCAAATCTCATAACACATCAGAAAATCCACACTAGGGAGAAACCCTATGAATGTGGTGACTGCGGGAAAACCTTCACCTGGAAGTCACGCCTCAATATACATCAGAAGTCTCATACTGGAGAAAGACACTATGAATGTAGTAAATGTGGGAAAGCTTTCATCCAGAAAGCCACACTAAGTATGCATCAGATAATTCATACAGGAAAGAAACCTTATGCTTGTACAGAATGTCAGAAGGCCTTTACTGACAGATCGAATCTCATTAAACACCAGAAAATGCATAGTGGAGAAAAACGCTATAAAGCCAGTGACTGA

Length: 2340

View AllClose

0 Reviews

View AllClose