Cusabio pUC Plasmid

Human ZNF317 cDNA Clone BC009367 pUC Plasmid

(No reviews yet) Write a Review

SKU:: CSB-CL026663HU2
UPC:
MPN:
Availability:: Inquiry
Size:: 10 μg plasmid + 200μl Glycerol
Gene:: ZNF317
Gene ID:: 57693
Accession #:: BC009367
Plasmid:: pUC

€421.00

Current Stock:

Quantity:

Frequently bought together:

Description
0 Reviews

Description

Human ZNF317 cDNA Clone BC009367 pUC Plasmid | Cusabio

Gene Name: ZNF317

Gene ID: 57693

Accession Number: BC009367

Vector: pUC

Sequence: ATGGGAAGGCACGCTGGCAAGAGGCCCTATCACCGCCGCGACTATGGGGTAGCGTTCAAGGGCAGGCCGCACCTCACTCAGCACATGAGCATGTACGACGGGAGAAAAATGCATGAATGTCATCAGTGCCAAAAAGCCTTCACCACGAGCGCGTCCCTCACACGGCACAGGAGAATCCACACCGGGGAGAAGCCTTACGAGTGCAGCGACTGCGGGAAAGCCTTCAACGACCCTTCAGCCCTTAGGAGCCACGCAAGAACTCACCTCAAAGAGAAGCCCTTTGACTGCAGTCAGTGTGGAAATGCATTCCGGACCCTCTCGGCCCTGAAAATCCACATGCGAGTTCACACTGGCGAGAGGCCTTACAAGTGTGATCAGTGCGGGAAGGCTTACGGCCGGAGCTGCCACCTCATCGCACACAAGAGAACGCACACCGGAGAGAGGCCCTACGAGTGTCACGACTGTGGGAAAGCTTTCCAGCACCCCTCCCACCTCAAAGAGCACGTGAGGAATCACACGGGGGAGAAGCCCTACGCGTGCACGCAGTGCGGCAAAGCCTTCCGCTGGAAGTCCAACTTTAATTTGCACAAGAAGAACCACATGGTGGAGAAGACCTACGAATGTAAAGAATGCGGGAAATCCTTTGGCGATCTCGTGTCCCGGAGGAAACACATGAGGATTCACATCGTCAAGAAACCCGTGGAATGTCGGCAGTGCGGGAAGACCTTCCGAAACCAGTCCATCCTTAAGACTCACATGAACTCTCACACTGGAGAGAAACCATACGGGTGCGATCTCTGCGGGAAAGCTTTCAGCGCGAGTTCAAACCTCACCGCACACAGGAAGATACACACGCAAGAGAGACGCTACGAATGCGCCGCCTGCGGGAAAGTCTTCGGTGACTATTTATCCCGGCGGAGGCACATGAGCGTTCACCTTGTAAAGAAACGAGTTGAGTGTAGGCAGTGTGGCAAGGCCTTCAGGAACCAGTCAACGCTGAAGACGCACATGCGAAGCCACACGGGGGAGAAACCGTACGAATGCGATCACTGTGGGAAGGCCTTCAGCATAGGCTCCAACCTGAATGTGCACAGGCGGATCCACACCGGGGAGAAGCCCTACGAATGCCTTGTCTGCGGGAAAGCCTTCAGCGACCACTCATCCCTCAGGAGCCACGTGAAAACTCACCGGGGAGAGAAGCTCTTTGTGTCATCCGTGTGGAAAAGGCTCCAGTGA

Length: 1236

View AllClose

0 Reviews

View AllClose

Related Products
Customers Also Viewed

Related Products

Human ZNF317 cDNA Clone BC078154 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€347.00

Human ZNF317 cDNA Clone BC078154 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF317Gene ID: 57693Accession Number: BC078154Vector: Vector will be determined during the manufacturing process, either...

Human ZNF266 cDNA Clone BC126255 pUC Plasmid

Cusabio pUC Plasmid

€529.00

Human ZNF266 cDNA Clone BC126255 pUC Plasmid | CusabioGene Name: ZNF266Gene ID: 10781Accession Number: BC126255Vector: pUCSequence:...

Human ZNF471 cDNA Clone BC125221 pUC Plasmid

Cusabio pUC Plasmid

€588.00

Human ZNF471 cDNA Clone BC125221 pUC Plasmid | CusabioGene Name: ZNF471Gene ID: 57573Accession Number: BC125221Vector: pUCSequence:...

Human ZNF500 cDNA Clone BC121013 pUC Plasmid

Cusabio pUC Plasmid

€475.00

Human ZNF500 cDNA Clone BC121013 pUC Plasmid | CusabioGene Name: ZNF500Gene ID: 26048Accession Number: BC121013Vector: pUCSequence:...

Human ZNF524 cDNA Clone BC014666 pUC Plasmid

Cusabio pUC Plasmid

€306.00

Human ZNF524 cDNA Clone BC014666 pUC Plasmid | CusabioGene Name: ZNF524Gene ID: 147807Accession Number: BC014666Vector: pUCSequence:...

Customers Also Viewed

Human ZNF219 cDNA Clone BC000694 pUC Plasmid

Cusabio pUC Plasmid

€662.00

Human ZNF219 cDNA Clone BC000694 pUC Plasmid | CusabioGene Name: ZNF219Gene ID: 51222Accession Number: BC000694Vector: pUCSequence:...

Human ZNF200 cDNA Clone BC012909 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF200 cDNA Clone BC012909 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF200Gene ID: 7752Accession Number: BC012909Vector: Vector will be determined during the manufacturing process, either...

Human ZNF34 cDNA Clone BC028136 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€347.00

Human ZNF34 cDNA Clone BC028136 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF34Gene ID: 80778Accession Number: BC028136Vector: Vector will be determined during the manufacturing process, either...

Human ZNF44 cDNA Clone BC001868 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF44 cDNA Clone BC001868 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF44Gene ID: 51710Accession Number: BC001868Vector: Vector will be determined during the manufacturing process, either...

Human ZNF449 cDNA Clone BC065938 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF449 cDNA Clone BC065938 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF449Gene ID: 203523Accession Number: BC065938Vector: Vector will be determined during the manufacturing process,...

HSP90AA1 Antibody | CSB-RA011087A2HU

Cusabio Recombinant Antibodies

€373.00 - €555.00

HSP90AA1 Antibody | CSB-RA011087A2HU | CusabioHSP90AA1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com...

PLA2G2A Antibody, Biotin conjugated | CSB-PA11209D0Rb

Cusabio Polyclonal Antibodies

€315.80 - €488.70

PLA2G2A Antibody, Biotin conjugated | CSB-PA11209D0Rb | CusabioPLA2G2A Antibody, Biotin conjugated is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send...

Human ZNF581 cDNA Clone BC001219 pENTR223.1 or pUC Plasmid

Cusabio Customized Plasmid

€214.00

Human ZNF581 cDNA Clone BC001219 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF581Gene ID: 51545Accession Number: BC001219Vector: Vector will be determined during the manufacturing process, either...

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-BP747694DO

Cusabio Canis lupus familiaris Recombinants

€443.00 - €1,060.00

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-BP747694DO | CusabioAlternative Name(s): 1-O-acylceramide synthase ?ACS? ?LCAT-like lysophospholipase? ?LLPL? ?Lysophospholipase 3??Lysosomal...

CYP2E1 Antibody | CSB-PA216877

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CYP2E1 Antibody | CSB-PA216877 | CusabioCYP2E1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product Type:...

CYP2E1 Antibody | CSB-PA186108

Cusabio Polyclonal Antibodies

€315.80 - €488.70

CYP2E1 Antibody | CSB-PA186108 | CusabioCYP2E1 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product Type:...

Human Cytochrome P450 2E1 (CYP2E1) ELISA kit | CSB-EL006425HU

Cusabio Elisa

€540.45 - €4,913.85

Human Cytochrome P450 2E1 (CYP2E1) ELISA kit | CSB-EL006425HU | CusabioHuman Cytochrome P450 2E1 (CYP2E1) ELISA kit is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is...

Human ZNF253 cDNA Clone BC125063 pUC Plasmid

Cusabio pUC Plasmid

€490.00

Human ZNF253 cDNA Clone BC125063 pUC Plasmid | CusabioGene Name: ZNF253Gene ID: 56242Accession Number: BC125063Vector: pUCSequence:...

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-MP747694DO

Cusabio Canis lupus familiaris Recombinants

€529.00 - €5,145.00

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-MP747694DO | CusabioAlternative Name(s): 1-O-acylceramide synthase1 (ACS1) (LCAT-like lysophospholipase1) (LLPL1) (Lysophospholipase 3)...

Recombinant Agaricus bisporus Polyphenol oxidase 2 (PPO2) | CSB-EP522115AYJ

Cusabio Virus & Bacteria Recombinants

€352.00 - €1,702.00

Recombinant Agaricus bisporus Polyphenol oxidase 2 (PPO2) | CSB-EP522115AYJ | CusabioAlternative Name(s): Polyphenol oxidase 2(PPO2)(Phenolase 2)(EC 1.14.18.1)(Cresolase 2)(Tyrosinase 2)Gene Names:...

Recombinant Human Disco-interacting protein 2 homolog C (DIP2C), partial | CSB-BP897088HU

Cusabio Human Recombinants

€443.00 - €1,472.00

Recombinant Human Disco-interacting protein 2 homolog C (DIP2C), partial | CSB-BP897088HU | CusabioAlternative Name(s): DIP2 homolog CGene Names: DIP2CResearch Areas: Epigenetics and Nuclear...

Recombinant Agaricus bisporus Polyphenol oxidase 2 (PPO2) | CSB-BP522115AYJ

Cusabio Virus & Bacteria Recombinants

€443.00 - €2,021.00

Recombinant Agaricus bisporus Polyphenol oxidase 2 (PPO2) | CSB-BP522115AYJ | CusabioAlternative Name(s): PPO2;Phenolase 2;Cresolase 2;Tyrosinase 2Gene Names: PPO2Research Areas: MetabolismOrganism:...

ACVR2B Antibody | CSB-RA260702A0HU

Cusabio Recombinant Antibodies

€373.00 - €555.00

ACVR2B Antibody | CSB-RA260702A0HU | CusabioACVR2B Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Antibody...

Human Protein Wnt-2b (WNT2B) ELISA kit | CSB-EL026134HU

Cusabio Elisa

€138.52 - €4,666.74

Human Protein Wnt-2b (WNT2B) ELISA kit | CSB-EL026134HU | CusabioHuman Protein Wnt-2b (WNT2B) ELISA kit is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or...

Recombinant Human Activin receptor type-2B (ACVR2B), partial (Active) | CSB-AP005701HU

Cusabio Active Proteins

€162.00 - €288.00

Recombinant Human Activin receptor type-2B (ACVR2B) ,partial (Active) | CSB-AP005701HU | CusabioProtein Description: PartialAlternative Name (s) : Activin Receptor Type-2B; Activin Receptor Type IIB;...

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-YP747694DO

Cusabio Canis lupus familiaris Recombinants

€383.00 - €1,345.00

Recombinant Dog Phospholipase A2 group XV (PLA2G15) | CSB-YP747694DO | CusabioAlternative Name(s): 1-O-acylceramide synthase ?ACS? ?LCAT-like lysophospholipase? ?LLPL) (Lysophospholipase 3)...

Recombinant Human Disco-interacting protein 2 homolog A (DIP2A), partial | CSB-BP623930HU

Cusabio Human Recombinants

€443.00 - €1,472.00

Recombinant Human Disco-interacting protein 2 homolog A (DIP2A), partial | CSB-BP623930HU | CusabioAlternative Name(s): DIP2 homolog AGene Names: DIP2AResearch Areas: Epigenetics and Nuclear...

SKP2 Antibody | CSB-RA224072A0HU

Cusabio Recombinant Antibodies

€373.00 - €555.00

SKP2 Antibody | CSB-RA224072A0HU | CusabioSKP2 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Antibody...

SKP2 Antibody | CSB-PA021362GA01HU

Cusabio Polyclonal Antibodies

€470.50 - €990.50

SKP2 Antibody | CSB-PA021362GA01HU | CusabioSKP2 Antibody is Available at Gentaur Genprice with the fastest delivery.Online Order Payment is possible or send quotation to info@gentaur.com.Product...

Recombinant Human S-phase kinase-associated protein 2 (SKP2) | CSB-EP613392HU

Cusabio Human Recombinants

€245.00 - €1,277.00

Recombinant Human S-phase kinase-associated protein 2 (SKP2) | CSB-EP613392HU | CusabioAlternative Name(s): Cyclin-A/CDK2-associated protein p45F-box protein Skp2F-box/LRR-repeat protein 1p45skp2Gene...