Cusabio Customized Plasmid
Human ZNF3 cDNA Clone BC008031 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL026651HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF3
- Gene ID:
- 7551
- Accession #:
- BC008031
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human ZNF3 cDNA Clone BC008031 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: ZNF3
Gene ID: 7551
Accession Number: BC008031
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGTGTCCTTTAGGGCTCTTGGAGCAGCCAGACCATGTTTCCAAGAGAAACCTGGTGATATTGCCAGCAGACCCCCTGCCATCCCCCCCAGTTGTCCTGGGGCTGAATGGGCAAATCTGTCCAAACAGCTAGTAACCGGCTGTGAGGGAGAGGGTCAGAAGCACTTAGCGTTGGCCTCTGATTGCTGTCCTCTCTTGTCCTCTTCCCACTCCAATGATGAAAATGATTTTCTCTAA
Length: 237
Related Products
Human ZNF3 cDNA Clone BC011887 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF3 cDNA Clone BC011887 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF3Gene ID: 7551Accession Number: BC011887Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026651HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF3
- Gene ID:
- 7551
- Accession #:
- BC011887
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF3 cDNA Clone BC013603 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF3 cDNA Clone BC013603 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF3Gene ID: 7551Accession Number: BC013603Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026651HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF3
- Gene ID:
- 7551
- Accession #:
- BC013603
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF3 cDNA Clone BC025265 pUC Plasmid
Cusabio pUC Plasmid
€421.00
Human ZNF3 cDNA Clone BC025265 pUC Plasmid | CusabioGene Name: ZNF3Gene ID: 7551Accession Number: BC025265Vector: pUCSequence:...
- SKU:
- CSB-CL026651HU4
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF3
- Gene ID:
- 7551
- Accession #:
- BC025265
- Plasmid:
- pUC
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF177Gene ID: 7730Accession Number: BC012012Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026558HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF177
- Gene ID:
- 7730
- Accession #:
- BC012012
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF22Gene ID: 7570Accession Number: BC010642Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026588HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF22
- Gene ID:
- 7570
- Accession #:
- BC010642
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC