Cusabio Customized Plasmid
Human ZNF273 cDNA Clone BC019234 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL026627HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF273
- Gene ID:
- 10793
- Accession #:
- BC019234
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human ZNF273 cDNA Clone BC019234 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: ZNF273
Gene ID: 10793
Accession Number: BC019234
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTTAGATAACTACAGAAACCTGGTCTTCCTGGGTATTGCTGTCTCTAAGCCAGACCTGATCACTTGTCTGGAGCAAGGAAAAGAGCCCTGCAATATGAAGAGACATGCGATGGTAGCCAAACCCCCAGGTTGGAGTGCAGTGGCGTGA
Length: 150
Related Products
Human ZNF273 cDNA Clone BC063818 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€347.00
Human ZNF273 cDNA Clone BC063818 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF273Gene ID: 10793Accession Number: BC063818Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026627HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF273
- Gene ID:
- 10793
- Accession #:
- BC063818
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF273 cDNA Clone BC008386 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF273 cDNA Clone BC008386 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF273Gene ID: 10793Accession Number: BC008386Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026627HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF273
- Gene ID:
- 10793
- Accession #:
- BC008386
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF177Gene ID: 7730Accession Number: BC012012Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026558HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF177
- Gene ID:
- 7730
- Accession #:
- BC012012
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF22Gene ID: 7570Accession Number: BC010642Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026588HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF22
- Gene ID:
- 7570
- Accession #:
- BC010642
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF281 cDNA Clone BC060820 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€516.00
Human ZNF281 cDNA Clone BC060820 pENTR223.1 or pUC Plasmid | CusabioGene Name: ZNF281Gene ID: 23528Accession Number: BC060820Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL026637HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF281
- Gene ID:
- 23528
- Accession #:
- BC060820
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC