null

Human ZC3HAV1L cDNA Clone BC008842 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822222HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZC3HAV1L
Gene ID:
92092
Accession #:
BC008842
Plasmid:
pUC
€335.00
Frequently bought together:

Description

Human ZC3HAV1L cDNA Clone BC008842 pUC Plasmid | Cusabio

Gene Name: ZC3HAV1L

Gene ID: 92092

Accession Number: BC008842

Vector: pUC

Sequence: ATGGCGGAGCCCACAGTGTGCTCCTTCCTCACCAAGGTGCTGTGCGCCCACGGCGGCCGCATGTTCCTGAAGGACCTGCGCGGCCACGTGGAGCTGTCGGAGGCCAGGCTCCGGGACGTGCTGCAGCGCGCCGGGCCCGAGCGTTTCCTGCTGCAGGAGGTGGAGACGCAGGAGGGCCTCGGGGACGCGGAGGCCGAGGCGGCGGCCGGCGCGGTGGGCGGTGGCGGCACCTCCGCCTGGAGGGTGGTGGCCGTGTCCTCTGTGCGCCTCTGCGCCCGCTACCAGCGCGGCGAGTGCCAGGCCTGCGACCAGCTGCACTTCTGCCGCCGGCACATGCTGGGCAAGTGCCCCAACCGGGACTGCTGGTCTACCTGTACCCTTTCCCATGATATCCACACACCTGTCAACATGCAGGTCCTGAAAAGCCATGGACTTTTTGGTCTCAATGAAAACCAGCTTCGGATCCTGCTTTTGCAGAATGACCCCTGTCTTTTACCAGAGGTCTGTTTGCTCTACAACAAAGGGGAAGCCCTGTATGGCTACTGCAACCTCAAGGATAAATGCAACAAGTTTCATGTGTGCAAATCCTTTGTGAAAGGAGAATGCAAACTTCAGACCTGCAAACGGTCCCATCAGCTTATCCATGCTGCATCTTTGAAGCTGCTACAGGACCAAGGACTGAATATTCCAAGTGTTGTTAATTTTCAGATAATCTCCACCTACAAGCATATAAAGCTGCACAAGATGCTTGAAAATACAGATAATTCATCACCTTCGACTGAGCATTCACAAGGCCTTGAGAAGCAAGGAGTGCACGCAGCTGGAGCTGCAGAAGCTGGTCCTCTGGCTTCTGTCCCTGCTCAGTCGGCCAAGAAGCCCTGCCCAGTGTCTTGCGAGAAGTAA

Length: 903

View AllClose

0 Reviews

View AllClose