null

Human ZC3H12A cDNA Clone BC005001 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL701732HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ZC3H12A
Gene ID:
80149
Accession #:
BC005001
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human ZC3H12A cDNA Clone BC005001 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ZC3H12A

Gene ID: 80149

Accession Number: BC005001

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTGGCCCCTGTGGAGAGAAGCCTGTCCTGGAAGCCAGCCCCACCATGAGTCTGTGGGAATTTGAGGACAGCCACAGCCGTCAGGGCACCCCAAGGCCGGGTCAAGAGCTGGCCGCTGAGGAGGCCTCGGCCCTGGAACTGCAGATGAAGGTGGACTTCTTCCGGAAGCTGGGCTATTCATCCACGGAGATCCACAGCGTCCTGCAGAAGCTGGGCGTCCAGGCAGACACCAACACGGTGCTGGGTGAGCTGGTGAAACACGGGACAGCCACCGAGCGGGAGCGCCAGACCTCACCGGACCCCTGCCCTCAGCTCCCTCTAGTCCCGCGGGGTGGTGGCACCCCTAAGGCTCCCAACCTGGAGCCTCCACTCCCAGAAGAGGAAAAGGAGGGCAGCGACCTGAGACCAGTGGTCATCGATGGGAGCAACGTGGCCATGAGCCATGGGAACAAGGAGGTCTTCTCCTGCCGGGGCATCCTGCTGGCAGTGAACTGGTTTCTGGAGCGGGGCCACACAGACATCACAGTGTTTGTGCCATCCTGGAGGAAGGAGCAGCCTCGGCCCGACGTGCCCATCACAGACCAGCACATCCTGCGGGAACTGGAGAAGAAGAAGATCCTGGTGTTCACACCATCACGACGCGTGGGTGGCAAGCGGGTGGTGTGCTATGACGACAGATTCATTGTGAAGCTGGCCTACGAGTCTGACGGGATCGTGGTTTCCAACGACACATACCGTGACCTCCAAGGCGAGCGGCAGGAGTGGAAGCGCTTCATCGAGGAGCGGCTGCTCATGTACTCCTTCGTCAATGACAAGTTTATGCCCCCTGATGACCCACTGGGCCGGCACGGGCCCAGCCTGGACAACTTCCTGCGTAAGAAGCCACTCACTTTGGAGCACAGGAAGCAGCCGTGTCCCTATGGAAGGAAATGCACCTATGGGATCAAGTGCCGATTCTTCCACCCAGAGCGGCCAAGCTGCCCCCAGCGCTCTGTGGCAGATGAGCTCCGTGCCAATGCTCTCCTCTCACCCCCCAGAGCCCCAAGCAAGGACAAAAATGGCCGGCGGCCTTCACCTTCATCCCAGTCCAGCTCTCTGCTAACAGAGAGTGAGCAGTGCAGCCTGGATGGGAAGAAGCTGGGGGCCCAGGCATCCCCAGGGTCCCGCCAAGAGGGTCTAACACAGACCTATGCCCCATCAGGCAGGAGCCTCGCACCTAGCGGGGGCAGTGGCAGCAGCTTTGGGCCCACAGACTGGCTCCCACAGACGCTGGACTCACTCCCGTACGTCTCCCAGGATTGCCTGGACTCGGGCATTGGCTCCCTGGAGAGCCAGATGTCGGAACTTTGGGGGGTTCGAGGAGGAGGCCCTGGTGAGCCGGGCCCACCCCGAGCCCCTTACACGGGCTACAGTCCCTATGGATCTGAGCTCCCAGCCACCGCAGCCTTCTCTGCCTTTGGCCGGGCCATGGGTGCTGGCCACTTCAGTGTCCCTGCCGACTACCCACCCGCGCCCCCTGCCTTTCCACCTCGAGAGTACTGGTCTGAACCATACCCACTGCCCCCACCCACATCAGTCCTTCAGGAGCCCCCAGTGCAGAGCCCAGGGGCTGGCAGGAGCCCGTGGGGCAGGGCAGACAGCCTGGCCAAGGAGCAGGCCAGCGTGTATACTAAGCTGTGTGGTGTGTTTCCCCCGCACCTGGTGGAGGCTGTGATGGGGCGCTTCCCACAGCTCCTGGACCCCCAGCAGCTGGCTGCCGAGATCCTCTCCTACAAGTCCCAGCACCCCAGTGAGTAA

Length: 1800

View AllClose

0 Reviews

View AllClose