null

Human XKR6 cDNA Clone BC024146 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL711015HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
XKR6
Gene ID:
286046
Accession #:
BC024146
Plasmid:
pUC
€383.00
Frequently bought together:

Description

Human XKR6 cDNA Clone BC024146 pUC Plasmid | Cusabio

Gene Name: XKR6

Gene ID: 286046

Accession Number: BC024146

Vector: pUC

Sequence: ATGATGTATGAATATGCAGACGTCAACATGCTGCGCCTCCTGGAGACCTTCCTGGAGAGCGCGCCCCAACTGGTGCTACAGCTCTACATCATGCTCCAGAAGAACAGCGCCGAGACCCTGCCCTGTGTCTCCTCTGTGACTTCCCTGATGTCCCTGGCTTGGGTGCTAGCCTCCTATCACAAGCTGCTGCGGGACTCCAGGGACGACAAGAAGAGCATGAGCTACAGAGGGGCCATCATCCAGGTCTTCTGGCGCCTCTTCACCATCTCATCCCGAGTGATCTCTTTTGCCCTCTTTGCTTCCATCTTCCAGCTCTATTTTGGGATCTTCGTGGTGGTTCACTGGTGCGCCATGGCCTTCTGGATCATCCATGGCGGAACAGACTTCTGCATGTCCAAGTGGGAGGAGATCCTCTTCAACATGGTGGTAGGGATCGTGTACATTTTCTGCTGGTTTAACGTCAAGGAAGGGCGGACTCGATATCGAATGTTTGCATATTATACGATAGTCTTGACCGAGAATGCTGCCTTGACGTTCCTTTGGTATTTTTACAGAGACCCGGAGACCACTGACTCCTATGCGGTGCCAGCACTGTGTTGTGTCTTTATTAGCTTTGTGGCTGGGATCGCAATGATGCTCTTATACTATGGCGTGCTGCATCCCACAGGACCACGAGCTAAGATCCTTGCCAGCTCCTGTTGTGCCGAGCTGCTCTGGGGCATCCCTTTGCCCCCCGATGTTGAGCCCATGGCGCCTGAGATCCCTGGGTACCGGGGGACCCAGGTTACGCCCACCAGAGCCGTAACGGAACAACAGGAGGATCTCACGGCTGACACTTGCTTGCCTGTTTTCCAAGTGAGACCCATGGGGCCCCCTACCCCGTTGGGGCGTCCTTACCTCCCAGAAGGGCCCCTCATTAAGATTGACATGCCAAGAAAGCGATACCCAGCTTGGGATGCTCATTTTGTAGACAGGAGGCTGAGAAGGACTATTAACATTCTACAATATGTCACCCCCACCGCAGTAGGCATTCGATATCGAGACGGACCACTCCTCTATGAGTTGCTACAGTATGAGTCTTCACTCTAA

Length: 1089

View AllClose

0 Reviews

View AllClose