null

Human VPS25 cDNA Clone BC006282 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL887108HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VPS25
Gene ID:
84313
Accession #:
BC006282
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human VPS25 cDNA Clone BC006282 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VPS25

Gene ID: 84313

Accession Number: BC006282

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGATGAGTTTCGAGTGGCCGTGGCAGTATCGCTTCCCACCCTTCTTTACGTTACAACCGAATGTGGACACTCGGCAGAAGCAGCTGGCCGCCTGGTGCTCGCTGGTCCTGTCCTTCTGCCGCCTGCACAAACAGTCCAGCATGACGGTGATGGAAGCTCAGGAGAGCCCGCTCTTCAACAACGTCAAGCTACAGCGAAAGCTTCCTGTGGAGTCGATCCAGATTGTATTAGAGGAACTGAGGAAGAAAGGGAACCTCGAGTGGTTGGATAAGAGCAAGTCCAGCTTCCTGATCATGTGGCGGAGGCCAGAAGAATGGGGGAAACTCATCTATCAGTGGGTTTCCAGGAGTGGCCAGAACAACTCCGTCTTTACCCTGTATGAACTGACTAATGGGGAAGACACAGAGGATGAGGAGTTCCACGGGCTGGATGAAGCCACTCTACTGCGGGCTCTGCAGGCCCTACAGCAGGAGCACAAGGCCGAGATCATCACTGTCAGCGATGGCCGAGGCGTCAAGTTCTTCTAG

Length: 531

View AllClose

0 Reviews

View AllClose