null

Human VILL cDNA Clone BC000243 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025856HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VILL
Gene ID:
50853
Accession #:
BC000243
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€438.00
Frequently bought together:

Description

Human VILL cDNA Clone BC000243 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VILL

Gene ID: 50853

Accession Number: BC000243

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGATGATTCAGTGGAATGGGCCCAAGACCAGCATTTCTGAGAAGGCTCGGGGGCTGGCTTTGACCTACAGCCTCCGGGACAGGGAACGTGGTGGTGGTCGTGCACAGATTGGTGTGGTGGATGATGAGGCCAAAGCCCCGGACCTCATGCAGATCATGGAGGCTGTGCTGGGCCGCAGGGTGGGCAGCCTGCGTGCCGCCACGCCCAGCAAGGATATCAACCAGCTGCAGAAGGCCAATGTTCGCCTGTACCATGTCTATGAGAAGGGCAAAGACCTGGTGGTCCTGGAGTTGGCGACCCCCCCACTGACCCAGGACCTGCTGCAGGAGGAGGACTTCTACATCCTGGACCAGGGTGGCTTCAAGATCTATGTGTGGCAGGGACGCATGTCTAGCCTCCAGGAGAGAAAGGCTGCCTTCAGCCGGGCTGTGGGCTTCATCCAGGCCAAGGGCTACCCGACCTACACCAACGTGGAGGTGGTGAACGACGGCGCCGAGTCGGCCGCGTTCAAGCAGCTCTTCCGGACTTGGTCTGAGAAGCGGCGCAGGAACCAGAAGCTCGGCGGGAGGGATAAATCGATTCATGTAAAGCTGGACGTGGGCAAGCTGCACACCCAGCCTAAGTTAGCGGCCCAGCTCAGGATGGTGGACGACGGCTCTGGGAAGGTGGAGGTGTGGTGCATCCAGGACTTACACAGGCAGCCCGTGGACCCCAAGCGTCATGGACAGCTGTGTGCAGGCAACTGCTACCTTGTGCTCTACACATACCAGAGGCTGGGCCGTGTCCAGTACATCCTGTACCTATGGCAGGGCCACCAGGCCACTGCGGATGAGATTGAGGCCCTGAACAGCAACGCTGAGGAACTAGATGTCATGTATGGTGGCGTCCTAGTACAGGAGCATGTGACCATGGGCAGCGAGCCCCCCCACTTCCTCGCCATCTTCCAGGGCCAGCTGGTGATCTTCCAGGAGAGAGCTGGGCACCATGGAAAGGGGCAGTCAGCATCCACCACAAGGCTTTTCCAAGTGCAAGGCACTGACAGCCACAACACCAGGACCATGGAGGTGCCAGCCCGTGCCTCATCCCTCAACTCCAGTGACATCTTCTTGCTGGTCACAGCCAGCGTCTGCTACCTCTGGTTTGGGAAGGGCTGTAATGGTGATCAGCGTGAGATGGCACGGGTGGTGGTCACTGTCATTTCCAGGAAGAATGAGGAAACGGTGCTGGAGGGTCAGGAGCCTCCCCACTTCTGGGAGGCCCTGGGAGGCCGGGCCCCCTACCCCAGCAACAAGAGGCTCCCTGAGGAGGTCCCCAGCTTCCAGCCACGACTGTTTGAGTGCTCCAGCCACATGGGCTGCCTGGTCCTCGCAGAAGTGGGGTTCTTCAGCCAGGAGGACCTGGACAAGTATGACATCATGTTACTGGACACCTGGCAGGAGATCTTCCTGTGGCTTGGGGAAGCTGCAAGTGAGTGGAAGGAGGCGGTGGCCTGGGGCCAGGAGTACCTGAAGACTCACCCAGCAGGGAGGAGCCCGGCCACACCCATCGTGCTGGTCAAGCAGGGCCATGAGCCTCCCACCTTCATTGGATGGTTCTTCACTTGGGACCCCTACAAGTGGACTAGCCACCCGTCCCACAAGGAAGTGGTGGATGGCAGCCCGGCAGCAGCATCAACCATCTCTGAGATAACAGCAGAAGTCAACAACTTGCGGCTATCCAGATGGCCGGGCAATGGCAGGGCAGGTGCCGTGGCCCTGCAGGCCCTCAAGGGCTCCCAGGACAGCTCAGAGAATGATCTGGTGCGAAGCCCCAAGTCGGCTGGCAGCAGAACCAGCAGCTCCGTCAGCAGCACCAGCGCCACGATCAACGGTGGCCTGCGCCGGGAACAACTGATGCACCAGGCTGTTGAGGACCTGCCAGAGGGCGTGGACCCTGCCCGCAGGGAGTTCTATCTCTCAGACTCTGACTTCCAAGATATCTTTGGGAAATCCAAGGAGGAATTCTACAGCATGGCCACGTGGAGGCAGCGGCAGGAGAAAAAGCAGCTGGGCTTCTTCTGA

Length: 2061

View AllClose

0 Reviews

View AllClose