null

Human VIL1 cDNA Clone BC017303 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025855HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VIL1
Gene ID:
7429
Accession #:
BC017303
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human VIL1 cDNA Clone BC017303 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VIL1

Gene ID: 7429

Accession Number: BC017303

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACCAAGCTGAGCGCCCAAGTCAAAGGCTCTCTCAACATCACCACCCCGGGGCTGCAGATATGGAGGATCGAGGCCATGCAGATGGTGCCTGTTCCTTCCAGCACCTTTGGAAGCTTCTTCGATGGTGACTGCTACATCATCCTGGCTATCCACAAGACAGCCAGCAGCCTGTCCTATGACATCCACTACTGGATTGGCCAGGACTCATCCCTGGATGAGCAGGGGGCAGCTGCCATCTACACCACACAGATGGATGACTTCCTGAAGGGCCGGGCTGTGCAGCACCGCGAGGTCCAGGGCAACGAGAGCGAGGCCTTCCGAGGCTACTTCAAGCAAGGCCTTGTGATCCGGAAAGGGGGCGTGGCTTCTGGCATGAAGCATGTGGAGACCAACTCCTATGACGTCCAGAGGCTGCTGCATGTCAAGGGCAAGAGGAACGTGGTAGCTGGAGAGGTAGAGATGTCCTGGAAGAGTTTCAACCGAGGGGATGTTTTCCTCCTGGACCTTGGGAAGCTTATCATCCAGTGGAATGGACCGGAAAGCACCCGTATGGAGAGACTCAGGGGCATGACTCTGGCCAAGGAGATCCGAGACCAGGAGCGGGGAGGGCGCACCTATGTAGGCGTGGTGGACGGAGAGAATGAATTGGCATCCCCGAAGCTGATGGAGGTGATGAACCACGTGCTGGGCAAGCGCAGGGAGCTGAAGGCGGCCGTGCCCGACACGGTGGTGGAGCCGGCACTCAAGGCTGCACTCAAACTGTACCATGTGTCTGACTCCGAGGGGAATCTGGTGGTGAGGGAAGTCGCCACACGGCCACTGACACAGGACCTGCTCAGTCACGAGGACTGTTACATCCTGGACCAGGGGGGCCTGAAGATCTACGTGTGGAAAGGGAAGAAAGCCAATGAGCAGGAGAAGAAGGGAGCCATGAGCCATGCGCTGAACTTCATCAAAGCCAAGCAGTACCCACCAAGCACACAGGTGGAGGTGCAGAATGATGGGGCTGAGTCGGCCGTCTTTCAGCAGCTCTTCCAGAAGTGGACAGCGTCCAACCGGACCTCAGGCCTAGGCAAAACCCACACTGTGGGCTCCGTGGGTGAGGGCCAGGCGGGGGCAGTGAGGGAGCCAGGATCCAGGAGCTGGGCCAGGAGAGCCACTTGGTCCACCACCCACCCTCCTTCCCTGACGTGCATCTTCAACGAAGACTTTTACGCTGGCTCTGGGCTTGTCCTAGCAGATGGGGACGTGGACAAACTCTAG

Length: 1266

View AllClose

0 Reviews

View AllClose