null

Human VEPH1 cDNA Clone BC113555 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL617949HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VEPH1
Gene ID:
79674
Accession #:
BC113555
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€516.00
Frequently bought together:

Description

Human VEPH1 cDNA Clone BC113555 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VEPH1

Gene ID: 79674

Accession Number: BC113555

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCATCAACTGTTCAGACTGGTTTTGGGACAAAAAGATCTTTCACGAGCTGGGGACCTCTTCTCCTTAGATGACTCTGAGATTGAAGACAGCCTTACAGAAGCTTTGGAGCAAATTAAGATAATTAGCTCATCTTCAGATTACCAAACCAATAACAATGACCAGGCAGTAGTTGAAATCTGTATCACAAGAATCACAACAGCCATCAGAGAGACCGAGTCCATTGAAAAGCATGCAAAGGCCCTTGTGGGGCTCTGGGACTCCTGCTTGGAACATAACCTGAGACCCTTTGGGAAAGACGAAGACACTCCTCATGCAAAAATCGCATCTGATATCATGAGTTGCATTTTACAGAATTACAACCGACCCCCAGTGATGGCATTAGCCATCCCCATTGCAGTGAAATTCCTCCACAGAGGCAACAAGGAACTGTGCAGGAATATGTCTAACTACCTGTCTCTGGCTGCAATTACCAAGGCAGATCTCCTGGCTGATCACACGGAAGTTATAGTAAAGAGCATACTCCAAGGTAACACCATGTTGTTGAGAGTGTTACCTGCTGTGTATGAAAAGCAGCCTCAGCCAATTAATAGACACCTGACAGAACTCCTGGCCTTGATGTCTCAGCTGGAACAGCCAGAACAGTACCATCTACTACGGCTTTTGCATGTAGCAGCAAAGAAAAAACAACTCGAGGTAGTTCAGAAGTGTATTCCTTTCCTAATTGGGCATTTGAAGGATTCAACCCATAATGACATCATCCTAAACATCCTCATAGAGATAGCAGTCTATGAGCCAGTGGCTTTGAACAGTTTTCTTCCAATGCTGAAAGAGATTGGTGAGAGATTCCCCTACCTCACTGGACAGATGGCAAGGATTTATGGAGCTGTTGGGCATGTGGATGAAGAGAGAGCCAGGAGCTGCCTGACATACCTGGTGAGCCAACTGGCCAACATGGAGCATTCGTTTCACCATATTCTCCTGCTGGAGATTAAAAGCATCACCGACACCTTCTCCTCAATCTTGGGCCCTCAGAGCAGAGACATCTTCCGCATGAGCAACAGCTTCACCGCCATTGCTAAACTCCTTACCCGACAACTGGAAAATACCAAGGCTGGAAGTGGCAGGAGAAAAATCAGCACTGAAATTGAATTCCCTGAGAAACTGGAAGAAACCAAGCTCATAGTAACTGAAAATGAAGACCATGAAAAACTCCAAGTTAAAATCCAGGCTTTTGAAGACAAGATAAATGCAGGGAGCAATACCCCTGGCTCTATCAGAAGATATAGTCTGGGCCAAGTTTCTAAAGAAGAAAGAAAAAACATTAGATTTAACAGGTCAAAAAGTTTGGCTTTCCACACTATGCTCACAAAGGGTGTGGGTTCAGATGACGGCGAAGATGAAAACAGGGGAGACATACCAGCCAGCATCTCTCTTTCAGAAATAGACCCACTTGGCCAAGGAAATGACAAGCTGCCGTTTAAGACAGACACTGAGAGATCACAGCTGGGGGAGTCTTCAGTTTCATACCCAAATATTATACATATAGACTCAGAGAATTTGTCAGAAACTGTTAAAGAAAACTCCCAGGAAGAAACTCCAGAGACAACTGCAAGTCCTATAGAATACCAAGATAAGCTCTACTTGCACTTAAAAAAAAACCTCAGCAAAGTGAAAGCATATGCCATGGAAATTGGAAAGAAGATTCCAGTCCCTGATCAGTGTACCATTGAAGACACTGTGAGAAGTTGTGTAGCAAAGTTGTTCTTCACCTGCTCCCTGAAGGGTCATTACTGCCTATACAGTAAGTCCAGTTTTATTCTCATCAGCCAAGAACCTCAGCCATGGATCCAGATCATGTTTCTATTTCAGCAGAGCCTGTTTCCTGAACCCCTGTCCATTCAGAGTCATTCTGTGCAATTCCTCAGAGCTCTGTGGGAGAAGACCCAGGCAGGGGGTGCTCACAGCTTTGAAACTGCCATGATGGAGTCCACGTTTCCACAGCAGAAGGATCTGGACCAGGTACAGCTCCATCTGGAAGAAGTGAGGTTCTTTGACGTGTTTGGCTTCAGTGAAACAGCAGGAGCATGGCAATGCTTCATGTGCAACAATCCTGAGAAAGCAACTGTTGTAAATCAAGATGGCCAGCCTCTCATAGAAGGAAAACTTAAAGAGAAGCAAGTCAGATGGAAGTTCATCAAAAGGTGGAAAACACGCTATTTTACACTGGCTGGAAATCAACTTCTGTTTCAAAAAGGAAAGTCTAAAGATGACCCTGACGACTGCCCAATAGAACTCAGCAAAGTACAGAGTGTGAAGGCTGTGGCCAAGAAACGCAGGGACCGCTCTCTCCCCCGGGCTTTCGAAATCTTCACAGACAATAAAACCTATGTCTTTAAGGCCAAGGATGAGAAGAATGCAGAAGAATGGCTCCAGTGCATCAACGTGGCAGTTGCCCAAGCCAAAGAAAGGGAAAGTAGAGAAGTAACCACATATCTGTAG

Length: 2502

View AllClose

0 Reviews

View AllClose