null

Human VCAN cDNA Clone BC050524 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025810HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VCAN
Gene ID:
1462
Accession #:
BC050524
Plasmid:
pUC
€376.00
Frequently bought together:

Description

Human VCAN cDNA Clone BC050524 pUC Plasmid | Cusabio

Gene Name: VCAN

Gene ID: 1462

Accession Number: BC050524

Vector: pUC

Sequence: ATGTTCATAAATATAAAGAGCATCTTATGGATGTGTTCAACCTTAATAGTAACCCATGCGCTACATAAAGTCAAAGTGGGAAAAAGCCCACCGGTGAGGGGCTCCCTCTCTGGAAAAGTCAGCCTACCTTGTCATTTTTCAACGATGCCTACTTTGCCACCCAGTTACAACACCAGTGAATTTCTCCGCATCAAATGGTCTAAGATTGAAGTGGACAAAAATGGAAAAGATTTGAAAGAGACTACTGTCCTTGTGGCCCAAAATGGAAATATCAAGATTGGTCAGGACTACAAAGGGAGAGTGTCTGTGCCCACACATCCCGAGGCTGTGGGCGATGCCTCCCTCACTGTGGTCAAGCTGCTGGCAAGTGATGCGGGTCTTTACCGCTGTGACGTCATGTACGGGATTGAAGACACACAAGACACGGTGTCACTGACTGTGGATGGGGTTGTGTTTCACTACAGGGCGGCAACCAGCAGGTACACACTGAATTTTGAGGCTGCTCAGAAGGCTTGTTTGGACGTTGGGGCAGTCATAGCAACTCCAGAGCAGCTCTTTGCTGCCTATGAAGATGGATTTGAGCAGTGTGACGCAGGCTGGCTGGCTGATCAGACTGTCAGATATCCCATCCGGGCTCCCAGAGTAGGCTGTTATGGAGATAAGATGGGAAAGGCAGGAGTCAGGACTTATGGATTCCGTTCTCCCCAGGAAACTTACGATGTGTATTGTTATGTGGATCATCTGGATGGTGATGTGTTCCACCTCACTGTCCCCAGTAAATTCACCTTCGAGGAGGCTGCAAAAGAGTGTGAAAACCAGGATGCCAGGCTGGCAACAGTGGGGGAACTCCAGGCGGCATGGAGGAACGGCTTTGACCAGTGCGATTACGGGTGGCTGTCGGATGCCAGCGTGCGCCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGTGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACAGGCTTCCCTCCCCCTGATAGCAGATTTGATGCCTACTGCTTTAAACGTAAGTGTTTGATACCTTTTTAA

Length: 1065

View AllClose

0 Reviews

View AllClose