null

Human VBP1 cDNA Clone BC046094 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025808HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VBP1
Gene ID:
7411
Accession #:
BC046094
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human VBP1 cDNA Clone BC046094 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VBP1

Gene ID: 7411

Accession Number: BC046094

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGGCCGTTAAGGACAGTTGTGGCAAAGGAGAAATGGCCACAGGGAATGGGCGGCGGCTCCACCTGGGGATTCCTGAGGCCGTGTTTGTGGAAGATGTAGATTCCTTCATGAAACAGCCTGGGAATGAGACTGCAGATACAGTATTAAAGAAGCTGGATGAACAGTACCAGAAGTATAAGTTTATGGAACTCAACCTTGCTCAAAAGAAAAGAAGGCTAAAAGGTCAGATTCCTGAAATTAAACAGACTTTGGAAATTCTAAAATACATGCAGAAGAAAAAAGAGTCCACCAACTCAATGGAGACCAGATTCTTGCTGGCAGATAACCTGTATTGCAAAGCTTCAGTTCCTCCTACCGATAAAGTGTGTCTGTGGTTGGGGGCTAATGTAATGCTTGAATATGATATTGATGAAGCTCAGGCATTGTTGGAAAAGAATTTATCGACTGCCACAAAGAATCTTGATTCCCTGGAGGAAGACCTTGACTTTCTTCGAGATCAATTTACTACCACAGAAGTCAATATGGCCAGGGTTTATAATTGGGATGTAAAAAGAAGAAACAAGGATGACTCTACCAAGAACAAAGCATAA

Length: 594

View AllClose

0 Reviews

View AllClose