null

Human VANGL1 cDNA Clone BC065272 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL848385HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
VANGL1
Gene ID:
81839
Accession #:
BC065272
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human VANGL1 cDNA Clone BC065272 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: VANGL1

Gene ID: 81839

Accession Number: BC065272

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGATACCGAATCCACTTATTCTGGATATTCTTACTATTCAAGTCATTCGAAAAAATCTCACAGACAAGGGGAAAGAACTAGAGAGAGACACAAGTCACCCCGGAATAAAGACGGCAGAGGGTCAGAAAAGTCTGTCACCATTCAACCTCCCACTGGAGAGCCCCTGTTGGGAAATGATTCTACTCGGACAGAGGAAGTTCAGGATGACAACTGGGGAGAGACCACCACGGCCATCACAGGCACCTCGGAGCACAGCATATCCCAAGAGGACATTGCCAGGATCAGCAAGGACATGGAGGACAGCGTGGGGCTGGATTGCAAACGCTACCTGGGCCTCACCGTCGCCTCTTTTCTTGGACTTCTAGTTTTCCTCACCCCTATTGCCTTCATCCTTTTACCTCCGATCCTGTGGAGGGATGAGCTGGAGCCTTGTGGCACAATTTGTGAGGGGCTCTTTATCTCCATGGCATTCAAACTCCTCATTCTGCTCATAGGGACCTGGGCACTTTTTTTCCGCAAGCGGAGAGCTGACATGCCACGGGTGTTTGTGTTTCGTGCCCTTTTGTTGGTCCTCATCTTTCTCTTTGTGGTTTCCTATTGGCTTTTTTACGGGGTCCGCATTTTGGACTCTCGGGACCGGAATTACCAGGGCATTGTGCAATATGCAGTCTCCCTTGTGGATGCCCTCCTCTTCATCCATTACCTGGCCATCGTCCTGCTGGAGCTCAGGCAGCTGCAGCCCATGTTCACGCTGCAGGTGGTCCGCTCCACCGATGGCGAGTCCCGCTTCTACAGCCTGGGACACCTGAGTATCCAGCGAGCAGCATTGGTGGTCCTAGAAAATTACTACAAAGATTTCACCATCTATAACCCAAACCTCCTAACAGCCTCCAAATTCCGAGCAGCCAAGCATATGGCCGGGCTGAAAGTCTACAATGTAGATGGCCCCAGTAACAATGCCACTGGCCAGTCCCGGGCCATGATTGCTGCAGCTGCTCGGCGCAGGGACTCAAGCCACAACGAGTTGTATTATGAAGAGGCCGAACATGAACGGCGAGTAAAGAAGCGGAAAGCAAGGCTGGTGGTTGCAGTGGAAGAGGCCTTCATCCACATTCAGCGTCTCCAGGCTGAGGAGCAGCAGAAAGCCCCAGGGGAGGTGATGGACCCTAGGGAGGCCGCCCAGGCCATTTTCCCCTCCATGGCCAGGGCTCTCCAGAAGTACCTGCGCATCACCCGGCAGCAGAACTACCACAGCATGGAGAGCATCCTGCAGCACCTGGCCTTCTGCATCACCAACGGCATGACCCCCAAGGCCTTCCTAGAACGGTACCTCAGTGCGGGCCCCACCCTGCAATATGACAAGGACCGCTGGCTCTCTACACAGTGGAGGCTTGTCAGTGATGAGGCTGTGACTAATGGATTACGGGATGGAATTGTGTTCGTCCTTAAGTGCTTGGACTTCAGCCTCGTAGTCAATGTGAAGAAAATTCCATTCATCATACTCTCTGAAGAGTTCATAGACCCCAAATCTCACAAATTTGTCCTTCGCTTACAGTCTGAGACATCCGTTTAA

Length: 1575

View AllClose

0 Reviews

View AllClose