null

Human UBE2Q2 cDNA Clone BC034342 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL845153HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2Q2
Gene ID:
92912
Accession #:
BC034342
Plasmid:
pUC
€170.00
Frequently bought together:

Description

Human UBE2Q2 cDNA Clone BC034342 pUC Plasmid | Cusabio

Gene Name: UBE2Q2

Gene ID: 92912

Accession Number: BC034342

Vector: pUC

Sequence: ATGGAACTTCTCACAAAACAGGGCTGGAGCAGTGCCTACTCAATAGAATCGGTCATCATGCAAATAAATGCCACCTTAGTCAAAGGCAAAGCCAGAGTGCAGTTTGGAGCAAATAAGAATCAATATAATCTAGCAAGAGCCCAACAATCCTATAATTCCATTGTACAGATACATGAGAAAAATGGCTGGTACACCCCTCCAAAGGAAGATGGCTAA

Length: 216

View AllClose

0 Reviews

View AllClose