null

Human UBE2Q2 cDNA Clone BC017708 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL845153HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2Q2
Gene ID:
92912
Accession #:
BC017708
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human UBE2Q2 cDNA Clone BC017708 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: UBE2Q2

Gene ID: 92912

Accession Number: BC017708

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCCGTGTCAGGGCTCAAGGCCGAGCTGAAGTTCCTGGCGTCCATCTTCGACAAGAACCACGAGCGATTCCGCATCGTCAGTTGGAAGCTGGACGAGCTGCACTGCCAGTTCCTGGTGCCGCAGCAGGGCAGCCCGCACTCGCTGCCGCCGCCACTCACGCTCCACTGCAACATCACGGAATCCTATCCATCTTCTTCACCGATATGGTTTGTGGATTCTGAAGACCCAAATCTGACATCAGTTCTGGAACGTCTAGAAGATACTAAGAACAACAATTTGCTTCGTCAGCAATTGAAGTGGTTGATATGTGAACTCTGCAGTTTATATAACCTTCCTAAGCACCTGGATGTTGAGATGCTAGATCAACCACTACCCACGGGTCAGAATGGGACAACAGAAGAAGTGACTTCAGAAGAAGAGGAAGAAGAAGAAGAGATGGCTGAAGATATAGAAGACTTAGATCACTATGAGATGAAGGAAGAAGAGCCTATTAGTGGGAAAAAGTCAGAGGATGAAGGAATTGAAAAAGAAAATTTGGCAATATTAGAGAAAATTAGGAAGACTCAAAGGCAAGACCATTTAAATGGTGCAGTGTCTGGGTCAGTGCAAGCTTCAGATAGACTTATGAAAGAGCTCAGGGACATATACAGATCACAGAGTTATAAAACAGGGATTTATTCAGTGGAACTCATAAATGACAGTTTATATGACTGGCATGTTAAACTGCAGAAGGTTGACCCTGATAGTCCTTTGCACAGTGATCTTCAGATCTTAAAAGAAAAAGAAGGCATAGAATATATTTTGCTTAACTTCTCTTTTAAGGATAACTTTCCATTTGATCCTCCATTTGTTCGAGTGGTGTTACCTGTTCTCTCAGGAGGGTATGTATTGGGTGGAGGAGCATTATGTATGGAACTTCTCACAAAACAGGGCTGGAGCAGTGCCTACTCAATAGAATCGGTCATCATGCAAATAAATGCCACCTTAGTCAAAGGCAAAGCCAGAGTGCAGTTTGGAGCAAATAAGAATCAATATAATCTAGCAAGAGCCCAACAATCCTATAATTCCATTGTACAGATACATGAGAAAAATGGCTGGTACACCCCTCCAAAGGAAGATGGCTAA

Length: 1128

View AllClose

0 Reviews

View AllClose