null

Human UBE2J2 cDNA Clone BC113430 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL843143HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBE2J2
Gene ID:
118424
Accession #:
BC113430
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human UBE2J2 cDNA Clone BC113430 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: UBE2J2

Gene ID: 118424

Accession Number: BC113430

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCAGCACCAGCAGTAAGAGGGCTCCGACCACGGCAACCCAGAGGCTGAAGCAGGACTACCTTCGCATTAAGAAAGACCCGGTGCCTTACATCTGTGCCGAGCCCCTCCCTTCGAATATTCTCGAGTGGCACTATGTCGTCCGAGGCCCAGAGATGACCCCTTATGAAGGTGGCTATTATCATGGAAAACTAATTTTTCCCAGAGAATTTCCTTTCAAACCTCCCAGTATCTATATGATCACTCCCAACGGGAGGTTTAAGTGCAACACCAGGCTGTGTCTTTCTATCACGGATTTCCACCCGGACACGTGGAACCCGGCCTGGTCTGTCTCCACCATCCTGACTGGGCTCCTGAGCTTCATGGTGGAGAAGGGCCCCACCCTGGGCAGTATAGAGACGTCGGACTTCACGAAAAGACAACTGGCAGTGCAGAGTTTAGCATTTAATTTGAAAGATAAAGTCTTTTGTGAATTATTTCCTGAAGTCGTGGAGGAGATTAAACAAAAACAGAAAGCACAAGACGAACTCAGTAGCAGACCCCAGACTCTCCCCTTGCCAGACGTGGTTCCAGACGGGGAGACGCACCTTGTCCAGAACGGGATTCAGCTGCTCAACGGGCATGCGCCGGGGGCCGTCCCAAACCTCGCAGGGCTCCAGCAGGCCAACCGGCACCACGGACTCCTGGGTGGCGCCCTGGCGAACTTGTTTGTGATAGTTGGGTTTGCAGCCTTTGCTTACACGGTCAAGTACGTGCTGAGGAGCATCGCGCAGGAGTGA

Length: 780

View AllClose

0 Reviews

View AllClose