null

Human UBASH3B cDNA Clone BC007541 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL840585HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBASH3B
Gene ID:
84959
Accession #:
BC007541
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€347.00
Frequently bought together:

Description

Human UBASH3B cDNA Clone BC007541 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: UBASH3B

Gene ID: 84959

Accession Number: BC007541

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTCAGTACGGCCACCCCAGTCCGCTCGGCATGGCTGCGAGAGAGGAGCTGTACAGCAAAGTCACCCCCCGGAGGAACCGCCAACAGCGCCCCGGCACCATCAAGCATGGATCGGCGCTGGACGTGCTCCTCTCCATGGGGTTCCCCAGAGCCCGCGCACAAAAAGCCTTGGCATCCACGGGAGGAAGAAGTGTTCAGGCAGCATGTGACTGGTTATTCTCCCATGTCGGTGACCCCTTCCTGGATGACCCCCTGCCCCGGGAGTACGTCCTCTACCTCCGTCCCACCGGCCCCTTAGCACAGAAGCTTTCCGACTTTTGGCAGCAGTCGAAGCAGATCTGCGGGAAGAACAAGGCACACAACATCTTCCCCCACATCACACTCTGCCAGTTCTTTATGTGCGAGGACAGCAAGGTGGATGCCCTGGGGGAAGCCCTGCAGACCACGGTCAGTCGCTGGAAATGTAAGTTCTCGGCCCCGCTGCCCCTGGAGCTCTATACGTCGTCCAACTTCATCGGCCTCTTTGTAAAGGAAGACAGTGCGGAGGTCCTCAAGAAGTTTGCTGCTGACTTTGCTGCAGAGGCTGCATCCAAAACCGAAGTGCATGTGGAACCTCATAAGAAGCAGCTACATGTGACCCTGGCTTACCACTTCCAAGCCAGCCACCTACCCACCCTAGAGAAACTGGCCCAGAACATTGACGTCAAGCTAGGGTGTGACTGGGTGGCTACCATATTTTCTCGGGATATCCGATTTGCTAACCATGAGACATTACAGGTCATCTACCCCTATACCCCACAAAATGACGATGAGCTGGAGCTGGTCCCCGGGGACTTCATCTTCATGTCTCCAATGGAGCAGACCAGCACCAGCGAGGGTTGGATCTATGGCACGTCCTTAACCACCGGCTGCTCTGGACTCCTGCCTGAGAATTACATTACCAAGGCTGATGAATGCAGCACCTGGATATTTCATGGTTCTTATTCAATCTTAAATACATCGTCATCCAACTCTCTCACGTTTGGGGATGGAGTATTGGAGAGGCGGCCTTATGAGGACCAGGGGCTCGGGGAGACGACTCCTCTTACTATCATCTGCCAGCCCATGCAGCCGCTGAGGGTCAACAGCCAGCCCGGCCCCCAGAAGCGATGCCTTTTTGTGTGTCGGCATGGTGAGAGGATGGATGTTGTGTTTGGGAAGTACTGGCTGTCCCAGTGCTTCGATGCCAAAGGCCGCTACATACGCACCAACCTGAACATGCCTCATAGTTTACCTCAGCGGAGTGGTGGTTTCCGAGATTACGAGAAAGATGCTCCCATCACTGTGTTTGGATGCATGCAAGCAAGACTAGTGGGTGAAGCCTTATTAGAGAGCAATACCATTATCGATCATGTCTATTGCTCCCCGTCCCTTCGCTGCGTTCAGACTGCACACAATATCTTGAAAGGTTTACAACAAGAAAATCACTTGAAGATCCGTGTAGAGCCCGGCTTATTTGAGTGGACAAAATGGGTTGCTGGGAGCACATTACCTGCATGGATACCTCCATCAGAGTTAGCTGCAGCCAACCTGAGTGTTGATACAACCTACAGACCTCACATTCCAATCAGCAAATTAGTTGTTTCAGAATCCTATGATACTTATATCAGTAGAAGTTTCCAAGTAACAAAAGAAATAATAAGTGAATGTAAAAGTAAAGGAAATAACATCCTGATTGTGGCCCACGCATCTTCCCTTGAAGCGTGTACCTGCCAACTTCAGGGCCTGTCACCTCAGAACTCCAAGGACTTCGTACAAATGGTCCGAAAGATCCCATATCTGGGATTTTGTTCCTGTGAAGAATTAGGAGAAACTGGAATATGGCAGCTGACAGATCCACCAATCCTTCCTCTTACCCATGGACCAACTGGGGGCTTCAACTGGAGAGAGACCTTGCTTCAAGAATAA

Length: 1950

View AllClose

0 Reviews

View AllClose