null

Human UBAP2L cDNA Clone BC003170 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL622754HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBAP2L
Gene ID:
9898
Accession #:
BC003170
Plasmid:
pUC
€1,078.00
Frequently bought together:

Description

Human UBAP2L cDNA Clone BC003170 pUC Plasmid | Cusabio

Gene Name: UBAP2L

Gene ID: 9898

Accession Number: BC003170

Vector: pUC

Sequence: ATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAACCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTAGACTTGCACAGATGATTTCGGACCATAATGATGCTGACTTTGAGGAGAAGGTGAAACAATTGATTGATATTACAGGCAAGAACCAGGATGAATGTGTGATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCTATCAATGTTCTTCTGGAAGGAAACCCAGACACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTCTCAGGCCAGAAGGATGGTGGCCAGACGGAATCCAATGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGGGGGAGAGGTGCCAGCCGTGGACGAGAGTTTCGAGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGAACAGAAAGAGGCAGAAGGGGCCGTGGCCGAGGCAGAGGTGGCTCTGGTAGGCGAGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCTGATTATGCAGAGCCAGCCAATACTGATGATAACTATGGCAATAGCAGCGGCAATACGTGGAACAACACTGGCCACTTTGAACCAGATGATGGGACGAGTGCATGGAGGACTGCAACAGAGGAGTGGGGGACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCGGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTGCTGGGGAAGACACCATCTACAATGGAGAATGATTCATCTAATCTGGATCCGTCTCAGGCTCCTTCTCTGGCCCAGCCTCTGGTGTTCAGTAATTCGAAGCAGACTGCCATATCACAGCCTGCTTCAGGGAACACATTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGTGAAGCTAAAGGCGGCAGTACTACAGGCTCCCAGTTCTTGGAGCAATTCAAGACTGCCCAAGCCCTGGCTCAGTTGGCAGCTCAGCATTCTCAGTCTGGAAGCACCACCACCTCCTCTTGGGACATGGGCTCGACGACACAATCCCCATCACTGGTGCAGTATGATTTGAAGAACCCAAGTGATTCAGCAGTGCACAGCCCCTTTACAAAGCGCCAGGCTTTTACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGTCACCTGCAGTGGCTACCTCCACAGCTGCACCTCCACCTCCGTCTTCTCCTCTGCCAAGCAAATCCACATCGGCTCCACAGATGTCGCCTGGATCTTCAGACAACCAGTCCTCTAGCCCTCAGCCGGCTCACCAGAAACTGAAACAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCAGCAGATATCTCAGGGCTAAACCTGCAGTTTGGGGCATTGCAGTTTGGGTCAGAGCCTGTCCTTTCTGATTATGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCAAGTAGCCTGTATACCAGCACGGCCAGTGAATCATCCTCTACAATTTCATCTAACCAGAGTCAGGAGTCTGGTTATCAGAGCGGCCCAATTCAGTCGACAACCTATACCTCCCAAAATAATGCTCAGGGCCCTCTTTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACACAATCTGTTGAAGGTGCTACAGGCTCTGCAGTGAAATCTGATTCACCTTCCACTTCTAGCATCCCCCCTCTCAATGAAACGGTATCTGCAGCTTCCTTACTGACGACAACCAATCAGCATTCATCCTCCTTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTACCACCACACAACACAGCAGCACGTTATCTACGCAGCAGAATACCCTTTCATCATCAACATCTTCTGGGCGCACTTCGACATCCACTCTTTTGCACACAAGTGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTTTCCACCACATCCAGCACAGTCTCTGCACCTCCCCCAGTGGTCAGTGTCTCCTCCAGTCTCAATAGTGGCAGTAGCCTGGGCCTCAGCCTAGGCAGCAACTCCACTGTCACAGCCTCGACTCGAAGCTCAGTTGCTACGACTTCAGGAAAAGCTCCTCCCAACCTCCCTCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTATATTATGGCTCCAGGGCTGTTACATGCCTACCCGCCACAAGTATATGGTTATGATGACTTGCAGATGCTTCAGACAAGATTTCCATTGGATTACTACAGCATCCCATTTCCCACACCCACTACTCCGCTGACTGGGAGGGATGGTAGCCTGGCCAGCAACCCTTATTCTGGTGACCTCACAAAGTTCGGCCGTGGGGATGCCTCCTCCCCAGCCCCGGCCACAACCTTGGCCCAACCCCAACAGAACCAGACGCAGACTCACCATACCACGCAGCAGACATTCCTGAACCCGGCGCTGCCTCCTGGCTACAGTTACACCAGCCTGCCATACTATACAGGGGTCCCGGGCCTCCCCAGCACCTTCCAGTATGGGCCTGCTGTGTTCCCTGTGGCTCCTACCTCTTCCAAGCAGCATGGTGTGAATGTCAGTGTGAATGCATCGGCCACCCCTTTCCAACAGCCGAGTGGATATGGGTCTCATGGATACAACACTGGTGTTTCAGTCACCTCCAGTAACACGGGCGTGCCAGATATCTCGGGTTCTGTGTACTCCAAAACCCAGCAGTCCTTTGAGAAACAAGGTTTTCATTCCGGTACTCCTGCTGCTTCCTTCAACTTGCCTTCAGCCCTAGGAAGTGGGGGCCCCATCAATCCGGCCACAGCTGCTGCCTACCCACCTGCCCCCTTTATGCACATTCTGACCCCCCATCAGCAGCCGCATTCTCAGATCCTTCACCATCACCTGCAGCAGGATGGCCAGACGGGCAGCGGGCAACGTAGCCAGACCAGCTCCATCCCGCAGAAGCCCCAGACCAACAAGTCTGCCTACAACAGCTACAGCTGGGGGGCCAACTGA

Length: 3264

View AllClose

0 Reviews

View AllClose