null

Human UBA6 cDNA Clone BC031637 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL025420HU1
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
UBA6
Gene ID:
55236
Accession #:
BC031637
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human UBA6 cDNA Clone BC031637 pENTR223.1 Plasmid | Cusabio

Gene Name: UBA6

Gene ID: 55236

Accession Number: BC031637

Vector: pENTR223.1

Sequence: ATGGAAGGATCCGAGCCTGTGGCCGCCCATCAGGGGGAAGAGGCGTCCTGTTCTTCCTGGGGGACTGGCAGCACAAATAAAAATTTGCCCATTATGTCAACAGCATCTGTGGAAATCGATGATGCATTGTATAGTCGACAGAGGTACGTTCTTGGAGACACAGCAATGCAGAAGATGGCCAAGTCCCATGTTTTCTTAAGTGGGATGGGTGGTCTTGGTTTGGAAATTGCAAAGAATCTTGTTCTTGCAGGGATTAAGGCAGTTACAATTCATGATACAGAAAAATGCCAAGCATGGGATCTAGGAACCAACTTCTTTCTCAGTGAAGATGATGTTGTTAATAAGAGAAACAGGGCTGAAGCTGTACTTAAACATATTGCAGAACTAAATCCATACGTTCATGTCACATCATCTTCTGTTCCTTTCAATGAGACCACAGATCTCTCCTTTTTAGATAAATACCAGTGTGTAGTATTGACTGAGATGAAACTTCCATTGCAGAAGAAGATCAATGACTTTTGCCGTTCTCAGTGCCCTCCAATTAAGTTTATCAGTGCAGATGTACATGGAATTTGGTCAAGGTTATTTTGTGATTTCGGTGATGAATTTGAAGTTTTAGATACAACAGGAGAAGAACCAAAAGAAATTTTCATTTCAAACATAACGCAAGCAAATCCTGGCATTGTTACTTGCCTTGAAAATCATCCTCACAAACTGGAGACAGGACAATTCCTAACATTTCGAGAAATTAATGGAATGACAGGTTTAAATGGATCTATACAACAAATAACGGTGATATCGCCATTTTCTTTTAGTATTGGTGACACCACAGAACTGGAACCATATTTACATGGAGGCATAGCTGTCCAAGTTAAGACTCCTAAAACAGTTTTTTTTGAATCACTGGAGAGGCAGTTAAAACATCCAAAGTGCCTTATTGTGGATTTTAGCAACCCTGAGGCACCTTTAGAGATTCACACAGCTATGCTTGCCTTGGACCAGTTTCAGGAGAAATACAGTCGCAAGCCAAATGTTGGATGCCAACAAGATTCAGAAGAACTGTTGAAACTAGCAACATCTATAAGTGAAACCTTGGAAGAGAAGGTGACTATTGAAATTTATGGCTGTCCGAATATTTGTTTGTTAATACATAAGTGTTCTGTATATTAG

Length: 1170

View AllClose

0 Reviews

View AllClose