Cusabio Customized Plasmid
Human TMEM14B cDNA Clone BC001033 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL023721HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM14B
- Gene ID:
- 81853
- Accession #:
- BC001033
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human TMEM14B cDNA Clone BC001033 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: TMEM14B
Gene ID: 81853
Accession Number: BC001033
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGAGAAGCCCCTCTTCCCATTAGTGCCTTTGCATTGGTTTGGCTTTGGCTACACAGCACTGGTTGTTTCTGGTGGGATCGTTGGCTATGTAAAAACAGGCAGCGTGCCGTCCCTGGCTGCATGGCTGCTCTTCGGCAGTCTAGCCGGCCTGGGTGCTTACCAGCTGTATCAGGATCCAAGGAACGTTTGGGGTTTCCTAGCCGCTACATCTGTTACTTTTGTTGGTGTTATGGGAATGAGATCCTACTACTATGGAAAATTCATGCCTGTAGGTTTAATTGCAGGTGCCAGTTTGCTGATGGCCGCCAAAGTTGGAGTTCGTATGTTGATGACATCTGATTAG
Length: 345
Related Products
Human TMEM14B cDNA Clone BC013913 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMEM14B cDNA Clone BC013913 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM14BGene ID: 81853Accession Number: BC013913Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023721HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM14B
- Gene ID:
- 81853
- Accession #:
- BC013913
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM14B cDNA Clone BC007080 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMEM14B cDNA Clone BC007080 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM14BGene ID: 81853Accession Number: BC007080Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023721HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM14B
- Gene ID:
- 81853
- Accession #:
- BC007080
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM14B cDNA Clone BC071660 pUC Plasmid
Cusabio pUC Plasmid
£151.20
Human TMEM14B cDNA Clone BC071660 pUC Plasmid | CusabioGene Name: TMEM14BGene ID: 81853Accession Number: BC071660Vector: pUCSequence:...
- SKU:
- CSB-CL023721HU4
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM14B
- Gene ID:
- 81853
- Accession #:
- BC071660
- Plasmid:
- pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£350.40
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC