Cusabio Customized Plasmid
Human TCEAL8 cDNA Clone BC035573 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL818261HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TCEAL8
- Gene ID:
- 90843
- Accession #:
- BC035573
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human TCEAL8 cDNA Clone BC035573 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: TCEAL8
Gene ID: 90843
Accession Number: BC035573
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCAAAAGTCTTGTGAAGAAAATGAGGGAAAACCACAGAACATGCCAAAGGCCGAGGAAGATCGCCCTTTGGAGGATGTACCACAGGAGGCAGAAGGAAATCCTCAACCTTCCGAAGAAGGCGTAAGCCAGGAAGCAGAAGGAAACCCCAGAGGAGGGCCGAATCAGCCTGGCCAGGGATTTAAAGAGGACACACCCGTTAGGCATTTGGACCCTGAAGAAATGATAAGAGGAGTAGATGAGCTTGAAAGGCTTAGGGAAGAGATAAGAAGAGTAAGAAACAAGTTTGTGATGATGCATTGGAAGCAAAGACATTCACGCAGCCGTCCTTATCCTGTGTGCTTTAGGCCTTGA
Length: 354
Related Products
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAP2K3Gene ID: 5606Accession Number: BC032478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013412HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAP2K3
- Gene ID:
- 5606
- Accession #:
- BC032478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAPK1IP1LGene ID: 93487Accession Number: BC015621Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL850865HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAPK1IP1L
- Gene ID:
- 93487
- Accession #:
- BC015621
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid | CusabioGene Name: MFSD11Gene ID: 79157Accession Number: BC002753Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013761HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MFSD11
- Gene ID:
- 79157
- Accession #:
- BC002753
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MED30 cDNA Clone BC008226 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MED30 cDNA Clone BC008226 pENTR223.1 or pUC Plasmid | CusabioGene Name: MED30Gene ID: 90390Accession Number: BC008226Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL822225HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MED30
- Gene ID:
- 90390
- Accession #:
- BC008226
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MED16 cDNA Clone BC004554 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£412.80
Human MED16 cDNA Clone BC004554 pENTR223.1 or pUC Plasmid | CusabioGene Name: MED16Gene ID: 10025Accession Number: BC004554Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL897475HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MED16
- Gene ID:
- 10025
- Accession #:
- BC004554
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MLPH cDNA Clone BC001653 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human MLPH cDNA Clone BC001653 pENTR223.1 or pUC Plasmid | CusabioGene Name: MLPHGene ID: 79083Accession Number: BC001653Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL014640HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MLPH
- Gene ID:
- 79083
- Accession #:
- BC001653
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MIF4GD cDNA Clone BC033759 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MIF4GD cDNA Clone BC033759 pENTR223.1 or pUC Plasmid | CusabioGene Name: MIF4GDGene ID: 57409Accession Number: BC033759Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013827HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MIF4GD
- Gene ID:
- 57409
- Accession #:
- BC033759
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MIS12 cDNA Clone BC000229 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MIS12 cDNA Clone BC000229 pENTR223.1 or pUC Plasmid | CusabioGene Name: MIS12Gene ID: 79003Accession Number: BC000229Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL875639HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MIS12
- Gene ID:
- 79003
- Accession #:
- BC000229
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MLF1 cDNA Clone BC007045 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human MLF1 cDNA Clone BC007045 pENTR223.1 or pUC Plasmid | CusabioGene Name: MLF1Gene ID: 4291Accession Number: BC007045Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL014621HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MLF1
- Gene ID:
- 4291
- Accession #:
- BC007045
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC